ID: 1042566472

View in Genome Browser
Species Human (GRCh38)
Location 8:70117122-70117144
Sequence GGCCACCAGGATGCACGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042566459_1042566472 20 Left 1042566459 8:70117079-70117101 CCTAACACTACTCTTTCCATTTT 0: 1
1: 0
2: 5
3: 58
4: 437
Right 1042566472 8:70117122-70117144 GGCCACCAGGATGCACGTGAAGG No data
1042566464_1042566472 4 Left 1042566464 8:70117095-70117117 CCATTTTGGGTTTAAAGGGCCCC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1042566472 8:70117122-70117144 GGCCACCAGGATGCACGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042566472 Original CRISPR GGCCACCAGGATGCACGTGA AGG Intronic
No off target data available for this crispr