ID: 1042566505

View in Genome Browser
Species Human (GRCh38)
Location 8:70117235-70117257
Sequence CTGGTGACCCAGACCAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042566505_1042566507 2 Left 1042566505 8:70117235-70117257 CCTTGATTGGTCTGGGTCACCAG 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1042566507 8:70117260-70117282 CTCTAAGTCTTCAGACTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042566505 Original CRISPR CTGGTGACCCAGACCAATCA AGG (reversed) Intronic
901644113 1:10707483-10707505 CTGATCACACAGAACAATCAGGG + Intronic
903605241 1:24570746-24570768 CTGGTGATGCAGACCACACATGG + Intronic
904044694 1:27602540-27602562 CCGGGGACCCAGACCCAGCAGGG + Intronic
905879292 1:41453192-41453214 CTGGTAACCCAGATCTATCTGGG + Intergenic
912494578 1:110083314-110083336 CTGCTTCCCCTGACCAATCAGGG + Intergenic
916151504 1:161796701-161796723 CTGGTCACCCAAAACCATCAAGG - Intronic
919788015 1:201272456-201272478 CTGGTGACCCTGACCATCAAGGG + Intergenic
921308604 1:213821171-213821193 CAGGTGACAGAGACAAATCAAGG - Intergenic
922760705 1:228128627-228128649 CTGGTCAGCCAGGCCAGTCAAGG + Intergenic
1063327899 10:5123340-5123362 CTGGTAGCACAGAGCAATCAGGG + Intronic
1063438750 10:6055247-6055269 CTAGTGAATCAGACCAACCATGG + Intronic
1067344750 10:45429087-45429109 CTGGAGACCAAGACCACTGAGGG + Intronic
1068208279 10:53886308-53886330 CTGGTTACACAGCCCACTCATGG + Intronic
1069424135 10:68274853-68274875 CTGGTCTCACAGACCAATCATGG + Intergenic
1075997345 10:126888900-126888922 CTGGTGACTCTGACCATTTAGGG - Intergenic
1077477283 11:2796492-2796514 CTGCCGACCCAGGCCTATCATGG + Intronic
1077486708 11:2842030-2842052 CTGGGGACCCACACCGCTCATGG - Intronic
1083937582 11:65878209-65878231 CTGGTGACCAAGACCAGAGAAGG - Intergenic
1084567608 11:69940292-69940314 CTGGGGACCCAGAGCACCCAAGG + Intergenic
1089116959 11:116103168-116103190 CTGGTCACCCAGAGCTTTCAGGG - Intergenic
1089392551 11:118111927-118111949 CTGGGGACCAAGGCCAGTCAGGG + Intronic
1089601641 11:119619266-119619288 CTGGTGACACTGGCCAAACAAGG + Intergenic
1094256822 12:28440133-28440155 CTTGTTAACCAGAGCAATCAGGG + Intronic
1100245470 12:92752618-92752640 CTTGTGACCCAGACCCTTCAGGG - Intronic
1101991498 12:109489342-109489364 CTAGAGACCCAGACCAAGCAAGG - Intronic
1107199774 13:37700345-37700367 CTGGAGAACCAGCCCATTCATGG - Intronic
1107311400 13:39082297-39082319 ATGATGACCCAGCCCAACCAGGG + Intergenic
1108730023 13:53225391-53225413 CTGGAGATCAAGACCAATCTGGG + Intergenic
1113427030 13:110216714-110216736 CTAGTGACCCAGAAAAAACAGGG - Intronic
1114549659 14:23525569-23525591 CTGGTGATCCAGTACAATGAAGG - Exonic
1117708882 14:58502500-58502522 TTGATAACACAGACCAATCATGG + Intronic
1119873951 14:78040818-78040840 CTGGTCACACAGACCAACCCTGG - Intergenic
1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG + Intergenic
1122459966 14:101886603-101886625 ATGAGGACCCAAACCAATCACGG - Intronic
1122476272 14:102011890-102011912 CAGATCACCCAGATCAATCATGG + Exonic
1122801009 14:104229481-104229503 TTGGTGACCCAGGCCACCCAGGG - Intergenic
1124652704 15:31485072-31485094 CTGGGGACCAAGACCAAGTAGGG - Intronic
1125730444 15:41890038-41890060 CTGGTGACCCAGCCCAGCCCTGG - Intronic
1126326089 15:47479148-47479170 CTGTTGACCAAGACCAAGCAAGG - Intronic
1129064363 15:72888854-72888876 TTGCAGACCCAGACCCATCACGG - Intergenic
1129866042 15:78909597-78909619 CTGGTGAACCTGAGCAATAAAGG + Intergenic
1134227256 16:12400601-12400623 CTGGTGTCCCAGACCAAAGCAGG + Intronic
1138292905 16:55863182-55863204 CTGTTGAACCAGACCTTTCACGG + Intronic
1140246075 16:73250998-73251020 CTGGTCACCCAAACAAATAATGG - Intergenic
1142836467 17:2591610-2591632 CTGGAGATCCAGACCAGCCAGGG - Intergenic
1148007806 17:44448347-44448369 CTGGAGTTCCAGACCAATCTAGG + Intronic
1148612948 17:48976897-48976919 TTGGTCACACAGACCAATCCTGG + Intergenic
1148963799 17:51417413-51417435 CTGGTGACCTGGATCAAACAGGG + Intergenic
1152047824 17:77949751-77949773 TTGGCCACCCAGACCAACCATGG - Intergenic
1154122067 18:11660080-11660102 ATGGTGAGCCAGACTATTCATGG - Intergenic
1157549535 18:48571801-48571823 CTGGAGACCCTGACTAATCCAGG - Intronic
1157607581 18:48935542-48935564 CTGGTGATCCAGACCCTTCCTGG - Intronic
1159189049 18:65017711-65017733 CTGGTGACCATGACCACCCATGG - Intergenic
1165266841 19:34667935-34667957 CTGGTCACCCTTACCAATCAGGG + Intronic
1166140332 19:40802000-40802022 CTGTGGCCCCAGACCAAGCACGG + Intronic
1166668501 19:44695852-44695874 GGGGTGACCCTGACCAAACAAGG + Intergenic
1166824636 19:45601329-45601351 ATGGTGACCCAGCCAAATCCTGG + Intronic
927667639 2:25043118-25043140 CTGGAGACCTAGACCAGTCTAGG + Intronic
930241148 2:48936907-48936929 CTGGTGACCCAGAACAATCCTGG + Intergenic
933727911 2:85436883-85436905 GTGGTGGCCTAGACCAGTCAGGG + Exonic
934127895 2:88916228-88916250 CTGGTAACCTAAACTAATCAAGG + Intergenic
939083873 2:137694072-137694094 CTGGTGACTCAGGACAATTATGG + Intergenic
941658115 2:168166199-168166221 ATGGTGACACAGGCCATTCAGGG + Intronic
941873785 2:170412849-170412871 CTGATGAGCCAGCCCCATCAGGG + Intronic
944709037 2:202319318-202319340 CTGGTGACCCTGAATAATAAGGG - Intergenic
946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG + Intronic
948723905 2:239920146-239920168 CTGCTGTCCCAGTCCCATCATGG - Intronic
1170323385 20:15127789-15127811 TTGGTCACCCAGACCAATGCTGG + Intronic
1172779697 20:37428893-37428915 CTGGTGTCCCAGAGGAATGATGG - Intergenic
1176978661 21:15353728-15353750 CGTGTGACACAGACCAAACAGGG - Intergenic
1177868712 21:26544627-26544649 CTGGTGACCCTGAAGAAACACGG + Intronic
1178399556 21:32273522-32273544 CTGGGGACTAAGACCAAACATGG + Intronic
1179531012 21:42019682-42019704 CTGGTGACCCTGACAAGTCGTGG - Intergenic
1180842942 22:18967701-18967723 CTGCTGACCCAGTCCAGGCAGGG + Intergenic
1181058526 22:20271027-20271049 CTGCTGACCCAGTCCAGGCAGGG - Intronic
1181107969 22:20585850-20585872 CTGGGGACCCAGGGCAAGCAGGG + Intronic
1181629409 22:24142718-24142740 CTGGTGCCCCACACCACTCCAGG + Intronic
1183564960 22:38607685-38607707 CTGGGGACCCAGGGCAACCAGGG + Intronic
950575214 3:13828127-13828149 TGGGTGACTCAGACCAGTCAGGG + Intronic
950934392 3:16823938-16823960 CTGGTGGCCCAGGCCTCTCAGGG + Intronic
960567179 3:119146155-119146177 CTGGCAACCTAGACCAGTCAGGG + Exonic
965516279 3:169624745-169624767 CTGTTTTCCCAGACCAAACATGG + Intronic
972120845 4:35700219-35700241 CTGGTGACCCTAACGAAACAGGG - Intergenic
973706331 4:53584497-53584519 CATGTGGCCCAGAACAATCAAGG + Intronic
986690655 5:10311058-10311080 TTGGTCACACAGACCAACCATGG - Intergenic
990810121 5:59714065-59714087 GTGCAGACCCAGACCAAGCAGGG - Intronic
992335669 5:75766240-75766262 CTGGGGAGGCAGAACAATCATGG - Intergenic
992361546 5:76043280-76043302 TTGGTCACACAGACCAATCCTGG - Intergenic
992952474 5:81874060-81874082 CTGCTGTCCCAGAACAAACAAGG + Intergenic
993953434 5:94202675-94202697 CCAGTGACCCAGGCCAATCTGGG + Intronic
994348077 5:98711454-98711476 CTGGTGAACCAGATAAGTCAAGG - Intergenic
997325211 5:133014814-133014836 CTGATCACACAGACCAACCATGG + Intronic
997484831 5:134221321-134221343 CAGGAGACCAAGACCAATCCTGG - Intronic
998477072 5:142431120-142431142 TTTCTGACCCAGGCCAATCAAGG + Intergenic
1001687617 5:173606159-173606181 ATGGTTACCCAAACCAATCTAGG + Intergenic
1004373576 6:15073378-15073400 CAGTTGACTCAGACCAACCAAGG - Intergenic
1008787141 6:55182291-55182313 TTGGTCACCCAGACCAATTCTGG - Intronic
1012945109 6:105457273-105457295 CTAATGACCCTGAACAATCAAGG + Intergenic
1018272871 6:162099245-162099267 CTGGTGACCTTGACCATTCAGGG + Intronic
1027624303 7:80528391-80528413 CTGGTGACTGAGACCAACCGGGG - Intronic
1028461306 7:91096183-91096205 TTGGTCACCAAGACCAATCCTGG - Intronic
1032096215 7:128939542-128939564 CATGTGACCCAGACCAACCCTGG + Intronic
1036514844 8:9434259-9434281 CTTTGGACCCAGACCAATTAGGG - Intergenic
1037564267 8:20104401-20104423 CCGTTGACCCAGAACAATGAAGG - Intergenic
1037707870 8:21330947-21330969 CTGGTGACCTAGGACCATCATGG - Intergenic
1039345292 8:36696985-36697007 CAGGTGTCCCAGACCAGCCAAGG - Intergenic
1042566505 8:70117235-70117257 CTGGTGACCCAGACCAATCAAGG - Intronic
1046725640 8:117670694-117670716 CTAGTAACCCAGAGCAATAATGG - Intergenic
1050192501 9:3042880-3042902 CTGGTGATCAAAACCAATGAGGG + Intergenic
1051846502 9:21457125-21457147 CTGGTGACCTTGACCAATGATGG + Intergenic
1054763618 9:69024874-69024896 CTGGTCACACAGACCAACCCTGG + Intergenic
1054784289 9:69195918-69195940 CTTGGGCACCAGACCAATCATGG - Intronic
1055772956 9:79736877-79736899 CTGGTGACACAGCTCAATCCTGG - Intergenic
1057147022 9:92765112-92765134 CTGGCGGCGCAGGCCAATCACGG - Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061206522 9:129167091-129167113 CTGGGGCTCCAGACCAATCCAGG - Intergenic
1062085468 9:134645853-134645875 CTGGGGGCCCAGTCCAAACAGGG + Intronic
1188906095 X:35793615-35793637 CTGGTTACCCAGACCCTACATGG + Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic