ID: 1042566953

View in Genome Browser
Species Human (GRCh38)
Location 8:70121315-70121337
Sequence ATGGATATGATTAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042566953_1042566958 -5 Left 1042566953 8:70121315-70121337 CCCTCCTGCTTAATCATATCCAT 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1042566958 8:70121333-70121355 TCCATTCCAGGCAGCTGGTTTGG 0: 1
1: 0
2: 3
3: 12
4: 177
1042566953_1042566960 -4 Left 1042566953 8:70121315-70121337 CCCTCCTGCTTAATCATATCCAT 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1042566960 8:70121334-70121356 CCATTCCAGGCAGCTGGTTTGGG 0: 1
1: 0
2: 4
3: 32
4: 222
1042566953_1042566963 22 Left 1042566953 8:70121315-70121337 CCCTCCTGCTTAATCATATCCAT 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1042566963 8:70121360-70121382 AGGTTGCCTCCCCTCAGAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 170
1042566953_1042566962 2 Left 1042566953 8:70121315-70121337 CCCTCCTGCTTAATCATATCCAT 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1042566962 8:70121340-70121362 CAGGCAGCTGGTTTGGGAACAGG 0: 1
1: 0
2: 5
3: 25
4: 339
1042566953_1042566957 -10 Left 1042566953 8:70121315-70121337 CCCTCCTGCTTAATCATATCCAT 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1042566957 8:70121328-70121350 TCATATCCATTCCAGGCAGCTGG 0: 1
1: 0
2: 4
3: 27
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042566953 Original CRISPR ATGGATATGATTAAGCAGGA GGG (reversed) Exonic
900809928 1:4794136-4794158 ATGGCTTTGATTAAGAAAGAAGG - Intergenic
903165633 1:21518514-21518536 ATGGATATTATTACAAAGGATGG + Intronic
905905895 1:41618336-41618358 ATGGACATGCTTAGGCAGGAAGG - Intronic
906297478 1:44658097-44658119 ATGGATATGAAAACCCAGGAAGG - Intronic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
907812544 1:57885947-57885969 AAGAATAAGATTAAGCAGGAGGG - Intronic
909348033 1:74615569-74615591 AAAGATATCATTAAACAGGAGGG + Intronic
909440866 1:75694095-75694117 ATGGAAATGACCAAGCAGAAAGG + Intergenic
911444908 1:97979780-97979802 ATGGATAAGATTTAGAAAGATGG + Intergenic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
912164932 1:107031639-107031661 ATGGTCTTGATTAGGCAGGAAGG - Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
915447093 1:155979970-155979992 ATGGACATTAGAAAGCAGGAAGG + Intronic
915919954 1:159968743-159968765 ATGGAAATGGTTAAGAAGTAGGG + Intergenic
916115655 1:161482968-161482990 ATGGCTATCATTAACCAGAAGGG + Intergenic
916869127 1:168893408-168893430 CTGGATAGGATTAAGCTGGCAGG - Intergenic
917015061 1:170520933-170520955 ATGGAAACTATTAAACAGGAGGG + Intergenic
917497780 1:175556978-175557000 ATGGTTTTGATGAAGCAAGAAGG + Intronic
918477265 1:184938261-184938283 ATGGAAATGAATAAGAAAGAAGG + Intronic
919128080 1:193420864-193420886 CTGTTTATGATTAAGCTGGAAGG + Intergenic
919322508 1:196061091-196061113 GTGGAAATGATTAGGCAGCAGGG - Intergenic
921110083 1:212027407-212027429 AGAGATAAGATTAAGAAGGAGGG + Intronic
922907627 1:229186543-229186565 ATGGAGATAATAAAGCAGGGAGG - Intergenic
924247653 1:242100518-242100540 ATGGAGATGAGGAAACAGGACGG - Intronic
924554828 1:245109373-245109395 CTGGGGATTATTAAGCAGGAGGG - Intronic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1068082287 10:52334227-52334249 ATGCATATGATCAATCAAGATGG - Intergenic
1068663975 10:59653117-59653139 TTGGATAAGAATAAGCAGGCAGG + Intronic
1070360678 10:75685512-75685534 ATGGATATGAATAGGCAGATAGG - Intronic
1074266098 10:111904940-111904962 GTTGAAATGTTTAAGCAGGAAGG - Intergenic
1074412841 10:113243042-113243064 ATGGATACGTGGAAGCAGGAGGG + Intergenic
1075295164 10:121268752-121268774 ATGGATGAGATAAAGCTGGAAGG + Intergenic
1079817176 11:25076470-25076492 ATGTATATGATAAAGAAGAAAGG + Intronic
1080173751 11:29337615-29337637 ATGAATATGATTTTCCAGGAAGG - Intergenic
1080343266 11:31294006-31294028 AGAGAAATGATTAAGCAGTATGG - Intronic
1081194443 11:40143948-40143970 ATGGAGATTACTAAGTAGGAAGG + Intronic
1081822091 11:46008892-46008914 AAGGATCTGATTAAGATGGAGGG - Intronic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1088456443 11:110037315-110037337 ATTGATAGGATTTAGGAGGAGGG - Intergenic
1094027185 12:25970978-25971000 ATGCATATGATATAGAAGGAAGG - Intronic
1095718801 12:45377694-45377716 ATGGATTTGAGGAAGCAGTATGG - Intronic
1096262621 12:50102669-50102691 ATGGGTAGGAGTAAGCAGGCAGG - Intergenic
1096866289 12:54565579-54565601 ATGGAGATGGTGCAGCAGGAAGG + Intronic
1097336604 12:58390656-58390678 AGGGAAATGATGAAGCATGAAGG - Intergenic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1099459752 12:82907762-82907784 TAGCATATGATTAAGCATGAAGG + Intronic
1102073511 12:110041678-110041700 ATCAATGTGTTTAAGCAGGATGG + Exonic
1107798585 13:44081163-44081185 ATGAATTTTATTGAGCAGGAAGG - Intergenic
1108138720 13:47394846-47394868 ATGGAGATCATGAAGCAGGGAGG - Intergenic
1109001160 13:56807575-56807597 ATGGCTATGATTAGACATGATGG + Intergenic
1110329418 13:74254090-74254112 ATGCATATAATTATGCATGAAGG - Intergenic
1110955158 13:81545094-81545116 ATGGATATGTTAAAGGTGGAAGG - Intergenic
1111968033 13:94880920-94880942 ATGGAAATCATCAAGGAGGATGG - Intergenic
1111985060 13:95057621-95057643 GTGGTTAGGATTAAGCAGCAAGG - Intronic
1114252386 14:20972322-20972344 ATGGAAAAAATAAAGCAGGAAGG + Intergenic
1115037651 14:28879551-28879573 ATGGATATTATTAAACAGCATGG + Intergenic
1115109225 14:29801436-29801458 ATGAACATGAATAAGCAGTAGGG + Intronic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1120033601 14:79670338-79670360 AGGGTGATGATTAAGCATGAGGG + Intronic
1120080066 14:80206134-80206156 ATGGATATGCTTATTCATGAAGG + Intronic
1121971285 14:98358709-98358731 ATGGATACTATTGACCAGGAAGG - Intergenic
1122355286 14:101119524-101119546 ATGGATATGTTCGAGAAGGATGG - Intergenic
1122971700 14:105154885-105154907 ATGGATTTGATCAAGCAGGAAGG - Intronic
1202844546 14_GL000009v2_random:156111-156133 AAGGATATGTCTAAGCAGAAGGG - Intergenic
1202913937 14_GL000194v1_random:146352-146374 AAGGATATGTCTAAGCAGAAGGG - Intergenic
1202878717 14_KI270722v1_random:36350-36372 AAGGATATGTCTAAGCAGAAGGG + Intergenic
1125252558 15:37722426-37722448 AGGGATATGAAAAAGCAGGGAGG - Intergenic
1125412110 15:39416412-39416434 ATGGGTATGATGGAGCAAGATGG + Intergenic
1127278822 15:57471413-57471435 ATGAACATGTTTAAGCAGGCTGG + Intronic
1129675011 15:77627817-77627839 ATGGATATGAGCAATCAGGGAGG - Intronic
1131504296 15:93002423-93002445 ATGGGTATGTTCAAGAAGGATGG + Intronic
1135719429 16:24802576-24802598 ATGGATGTGCTTTAGCAGGCAGG + Intronic
1141246292 16:82310701-82310723 ATGATCAGGATTAAGCAGGATGG - Intergenic
1141855035 16:86674895-86674917 ATGGATGTTAATGAGCAGGAAGG - Intergenic
1142881562 17:2885918-2885940 CTGGAAATGATTCGGCAGGAAGG + Intronic
1144423517 17:15119468-15119490 GTGGCTGTGATTAAGAAGGAGGG - Intergenic
1145731807 17:27195943-27195965 TTGGTTTTGATTCAGCAGGATGG + Intergenic
1145973201 17:28969016-28969038 ATGGTTAGGATTAAGCAAAATGG - Intronic
1146582760 17:34053763-34053785 CTGCATATGATTAAGCAGGTGGG - Intronic
1148789134 17:50163625-50163647 ATGGATGAAATTAATCAGGAGGG + Intergenic
1149628106 17:58094433-58094455 ATGGGTATAATTGAGCAGGGAGG - Exonic
1150301412 17:64050124-64050146 CTGGATGTGATAAACCAGGATGG + Intronic
1153322641 18:3788367-3788389 ATTGAAAGGATTAAGCAGGGGGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153496440 18:5704514-5704536 ATGAATAAGAGTATGCAGGAAGG - Intergenic
1154928799 18:20970561-20970583 AAGAATATGATTAAGTTGGAAGG - Intronic
1155393012 18:25356068-25356090 GTGGTTATGAGTATGCAGGATGG - Intergenic
1155485555 18:26338109-26338131 ATGGATAAGATTAGGAATGAAGG - Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1202654340 1_KI270708v1_random:5384-5406 AAGGATATGTCTAAGCAGAAGGG + Intergenic
925751422 2:7093452-7093474 ATGGACAGGAGTGAGCAGGACGG + Intergenic
926451004 2:13003781-13003803 ATGGATATGCTGAGGCATGATGG + Intergenic
927292891 2:21422115-21422137 ATGCATAGCCTTAAGCAGGAAGG + Intergenic
931180265 2:59892413-59892435 ATGGATGTTCTCAAGCAGGAAGG - Intergenic
932282450 2:70505748-70505770 ATGGATTAGATGAAGCAGAATGG - Intronic
935946828 2:108294252-108294274 GTGGATATGATTGAACAGAATGG + Exonic
935998199 2:108797141-108797163 GTGGATATAATTAAGCAGAAAGG + Intronic
936774093 2:115951568-115951590 ATTGATATGATTATGCAAAAAGG + Intergenic
945923592 2:215780853-215780875 TTGGATAGCATTAAGCTGGATGG - Intergenic
946753975 2:222924313-222924335 GTGGATGTGATTCAGCAAGAAGG - Intronic
1172844327 20:37920674-37920696 ATGGACATGCATAAGCAGGGAGG - Intronic
1174642435 20:52056132-52056154 ATATAAATGATGAAGCAGGAAGG - Intronic
1174823657 20:53749302-53749324 ATGGTGATGATTAAGTAAGAAGG + Intergenic
1176633292 21:9161027-9161049 AAGGATATGTCTAAGCAGAAGGG - Intergenic
1176640031 21:9293790-9293812 AAGGATATGTCTAAGCAGAAGGG + Intergenic
1180349044 22:11783172-11783194 AAGGATATGTCTAAGCAGAAGGG + Intergenic
1180373332 22:12066626-12066648 AAGGATATGTCTAAGCAGAAGGG + Intergenic
1180389155 22:12209041-12209063 AAGGATATGTCTAAGCAGAAGGG - Intergenic
1180416786 22:12725430-12725452 AAGGATATGTCTAAGCAGAAGGG + Intergenic
1180424077 22:12901253-12901275 AAGGATATGTCTAAGCAGAAGGG + Intergenic
1180647791 22:17353874-17353896 ATGGATATGATTATGCTGTTAGG - Intergenic
1182341573 22:29626062-29626084 ATCAATATGATTAAGCAAGTAGG - Intronic
1182720701 22:32396596-32396618 ATGGATTTGATTAATCATGAAGG - Intronic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1183810254 22:40250407-40250429 ATGGAAATGATTAACCTAGAAGG - Intronic
949454432 3:4223991-4224013 AAGGATAAGAGTAAGCAAGAAGG + Intronic
951598058 3:24339732-24339754 ATGGGTATGTTTAAGTTGGAAGG - Intronic
952720345 3:36525714-36525736 AGGGATTTAATTAAGCAGCAAGG - Intronic
952962669 3:38602463-38602485 ATTGGTATTAGTAAGCAGGAAGG - Intronic
953349621 3:42205613-42205635 TTGGTTATGATTAAGCAGAAAGG - Intronic
953768586 3:45762123-45762145 CAGGATCTGATTCAGCAGGATGG + Intronic
957100161 3:75816982-75817004 AAGGATATGTCTAAGCAGAAGGG - Intergenic
962557517 3:136570737-136570759 AGGGATATGCTTAATCAGCATGG - Intronic
962912402 3:139864967-139864989 CTGGAGATGAGTAGGCAGGAGGG - Intergenic
964188187 3:153972356-153972378 ATGGTTATAATGAGGCAGGAAGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
1202746864 3_GL000221v1_random:111232-111254 AAGGATATGTCTAAGCAGAAGGG - Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
970036800 4:11745542-11745564 ATAGAAATCATTAAGCATGATGG + Intergenic
971771483 4:30902864-30902886 AGGGATATTTTTAAACAGGAGGG - Intronic
975875201 4:78828112-78828134 ATGGCTAGAATAAAGCAGGAAGG + Intronic
977146716 4:93451488-93451510 ATGAATATGTTGAAGCAGGTTGG + Intronic
978604053 4:110459873-110459895 ATGGAGAGTTTTAAGCAGGAGGG + Intronic
979168800 4:117572983-117573005 ATGGAAATGATAAAACAGCAGGG + Intergenic
980491069 4:133530464-133530486 ATGCAGATGATTAAGCTGGCAGG - Intergenic
982642732 4:157983544-157983566 ATGGAAATGATTCAGCGGAAAGG - Intergenic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
1202754925 4_GL000008v2_random:52194-52216 AAGGATATGTCTAAGCAGAAGGG + Intergenic
985787307 5:1903938-1903960 AAGGATAAGATTGAGCAAGAGGG + Intergenic
985935764 5:3096628-3096650 ATGGATTTGATTAAGCAGCTCGG + Intergenic
989530979 5:42507966-42507988 ATGGATATGCTATAGGAGGAGGG + Intronic
989569223 5:42929678-42929700 AGGGTTATGATTAAGAAAGAAGG - Intergenic
990120182 5:52442030-52442052 ATTGATATGATGGAGGAGGAGGG - Intergenic
991356567 5:65775244-65775266 ATGGCTATGCTTAATGAGGATGG - Intronic
991434924 5:66588012-66588034 ATGCATATGAGGAAGCAGGTGGG + Intergenic
994942545 5:106343346-106343368 ATGGATTTGACTAAACAGTATGG - Intergenic
996773264 5:127107829-127107851 ATGAATAAAATGAAGCAGGAAGG - Intergenic
997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG + Intronic
998964577 5:147525332-147525354 ATGTATATTATTAATCAGTAAGG - Intergenic
1000190996 5:158910413-158910435 ATGGATATGCTGAAGAAGGTGGG + Intronic
1005820473 6:29594322-29594344 AGCAAAATGATTAAGCAGGAAGG + Intronic
1007137067 6:39532718-39532740 CTGGAAATAATTAAGCAGTATGG - Intronic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1011880995 6:92026531-92026553 ATAGAAATGATTAAGCGGAAAGG - Intergenic
1017462047 6:154660375-154660397 TTGGATATTATTAATCATGAGGG + Intergenic
1017731121 6:157317066-157317088 ATGGGAATGATTCAGCAGGGAGG - Intronic
1021209016 7:17821822-17821844 ATGGATGTGAATATGGAGGATGG - Intronic
1023230631 7:38024272-38024294 CTGGAGATGAGTAAGCAGGAGGG + Intronic
1026509345 7:71015586-71015608 ATGGATATTAAGAAGCAGAAGGG + Intergenic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1028859110 7:95627815-95627837 ATTGATGTAATTCAGCAGGAAGG + Intergenic
1029030787 7:97464262-97464284 ATGGACATGATAAAACTGGAAGG - Intergenic
1030392928 7:108949583-108949605 ATGGAAATGCTTATGCAGCATGG + Intergenic
1031159941 7:118154436-118154458 ATGTATTTGCTTTAGCAGGAAGG + Intergenic
1033238671 7:139658964-139658986 ATGGATGTCTTAAAGCAGGAGGG + Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1037538200 8:19847274-19847296 ATTGGTTTGCTTAAGCAGGATGG + Intronic
1039291128 8:36095431-36095453 ATAGATATGAGTCAGCAGGCAGG - Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1041990362 8:63981755-63981777 ATTGATTTGATTAAATAGGATGG + Intergenic
1042042780 8:64611254-64611276 ATGGAGGTGATTAAGAAGAAAGG - Intronic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1042610151 8:70589936-70589958 GTGAATATGGTAAAGCAGGAAGG + Intronic
1049175303 8:141189109-141189131 ACGGATTTGATTGTGCAGGACGG + Exonic
1051796245 9:20873908-20873930 ATGGAGATAATTAAGCATTAGGG - Intronic
1053200905 9:36151051-36151073 ATGGAAGAGATTAAACAGGAAGG - Intronic
1055352614 9:75404760-75404782 ATGGATAGGATTCAGTAGGTAGG + Intergenic
1057454597 9:95196860-95196882 AAGGAGACGATTAAGCAGCAAGG - Intronic
1058613101 9:106796121-106796143 ATGGATATAATTAACCAGAATGG + Intergenic
1203756133 Un_GL000218v1:128655-128677 AAGGATATGTCTAAGCAGAAGGG - Intergenic
1203715499 Un_KI270742v1:141325-141347 AAGGATATGTCTAAGCAGAAGGG - Intergenic
1203535718 Un_KI270743v1:36903-36925 AAGGATATGTCTAAGCAGAAGGG + Intergenic
1186025057 X:5300355-5300377 GTGGAAATGATCAAGCAGAAAGG + Intergenic
1186383516 X:9086091-9086113 AAGGATATGCTTAGGAAGGAAGG - Intronic
1186997565 X:15140012-15140034 ATAAAGATGAATAAGCAGGAGGG + Intergenic
1193252834 X:79312230-79312252 ATGGGGATAATTAAGCAAGAAGG + Intergenic
1197103713 X:122687956-122687978 AGGGATATAATTAACCAGGAAGG + Intergenic
1201169733 Y:11246273-11246295 AAGGATATGTCTAAGCAGAAGGG - Intergenic