ID: 1042568216

View in Genome Browser
Species Human (GRCh38)
Location 8:70134114-70134136
Sequence GTGGAGAAGAAGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2383
Summary {0: 1, 1: 0, 2: 20, 3: 259, 4: 2103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042568216 Original CRISPR GTGGAGAAGAAGCAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr