ID: 1042571824

View in Genome Browser
Species Human (GRCh38)
Location 8:70173640-70173662
Sequence GATAAGCAAGGGCCAACACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042571820_1042571824 -6 Left 1042571820 8:70173623-70173645 CCAGTGATTCTAGAGGAGATAAG 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1042571824 8:70173640-70173662 GATAAGCAAGGGCCAACACTGGG No data
1042571818_1042571824 23 Left 1042571818 8:70173594-70173616 CCTGGAAAGGGAGGCTGAATGTT 0: 1
1: 0
2: 1
3: 18
4: 203
Right 1042571824 8:70173640-70173662 GATAAGCAAGGGCCAACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042571824 Original CRISPR GATAAGCAAGGGCCAACACT GGG Intronic
No off target data available for this crispr