ID: 1042572667

View in Genome Browser
Species Human (GRCh38)
Location 8:70183856-70183878
Sequence ATTTGCTGCCTGGCACATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042572665_1042572667 2 Left 1042572665 8:70183831-70183853 CCTTGGCTGTAAGAAATGACTTT 0: 1
1: 0
2: 4
3: 45
4: 430
Right 1042572667 8:70183856-70183878 ATTTGCTGCCTGGCACATAGTGG No data
1042572663_1042572667 24 Left 1042572663 8:70183809-70183831 CCTTTTCACTACATTGCTGGCTC 0: 1
1: 0
2: 1
3: 9
4: 182
Right 1042572667 8:70183856-70183878 ATTTGCTGCCTGGCACATAGTGG No data
1042572662_1042572667 25 Left 1042572662 8:70183808-70183830 CCCTTTTCACTACATTGCTGGCT 0: 1
1: 0
2: 1
3: 19
4: 251
Right 1042572667 8:70183856-70183878 ATTTGCTGCCTGGCACATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042572667 Original CRISPR ATTTGCTGCCTGGCACATAG TGG Intronic
No off target data available for this crispr