ID: 1042573352

View in Genome Browser
Species Human (GRCh38)
Location 8:70191522-70191544
Sequence TGTAAGGTTCATCTCTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042573352_1042573354 23 Left 1042573352 8:70191522-70191544 CCTCTGAAGAGATGAACCTTACA 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1042573354 8:70191568-70191590 CTCATCATTTACCTATACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042573352 Original CRISPR TGTAAGGTTCATCTCTTCAG AGG (reversed) Intronic
905086781 1:35386887-35386909 TGTAAGGTACATCTGTTAACAGG - Intronic
906921879 1:50073173-50073195 TGGAGGGTACATCTCTACAGAGG + Intronic
910375122 1:86560240-86560262 TGTATGGTTCATCTCTACCTGGG - Exonic
911717331 1:101148163-101148185 TGTAGTGTTGTTCTCTTCAGAGG - Intergenic
912926492 1:113917744-113917766 TGTATGGTTCTTTTCTCCAGTGG - Intergenic
915056165 1:153133372-153133394 TGTGAGATTCATCTCTGGAGTGG - Intergenic
915845203 1:159256018-159256040 TGAAAGGTTCAAGACTTCAGTGG - Intergenic
917029937 1:170679111-170679133 TGTCAGTCTCATCTCTTCAAAGG + Intronic
918455521 1:184708659-184708681 TATGAGGTTTATTTCTTCAGAGG - Intronic
923401669 1:233621259-233621281 TGCAAGCTTCATTTCTTCTGAGG - Intronic
1063156103 10:3380737-3380759 TATAACGTTCGTCTCTTCAGTGG - Intergenic
1063313374 10:4978075-4978097 TTTAAGATTCATTTCTGCAGTGG + Exonic
1063314578 10:4989642-4989664 TTTAAGATTCATTTCTGCAGTGG - Exonic
1065015233 10:21456751-21456773 AGCATGGTTCATCTCTTCTGGGG + Intergenic
1065794889 10:29297378-29297400 TGTAAGGTTCATCACATGACCGG + Intronic
1066789368 10:39045748-39045770 TATAAGGTTAATGTCATCAGAGG - Intergenic
1067492637 10:46726238-46726260 TGTAAAGTTGATCTCTTCCAGGG + Intergenic
1067969732 10:50955778-50955800 TGTAATTTTAATCTCTTCATTGG + Intergenic
1068403845 10:56564491-56564513 GGTGTGGCTCATCTCTTCAGTGG - Intergenic
1070707678 10:78653011-78653033 TATATGATCCATCTCTTCAGGGG - Intergenic
1071653559 10:87421745-87421767 TGTAAAGTTGATCTCTTCCAGGG - Intergenic
1075831702 10:125417557-125417579 CTCAAGGTTCATCTCTCCAGAGG + Intergenic
1078027191 11:7708129-7708151 TGTTACTTTCATCTCTTAAGGGG + Intergenic
1079674599 11:23210103-23210125 TGTAAGGTGGAACTCTTCACAGG + Intergenic
1080858322 11:36131148-36131170 TGTAAGGCTCATGCCTTGAGAGG + Intronic
1081514316 11:43810533-43810555 TGCAAGGATCAACTCTTAAGAGG + Intronic
1084413580 11:69017700-69017722 TGTAAGCATCATCTCTGTAGAGG - Intergenic
1084501823 11:69539719-69539741 TGTAAGTTTAATTTTTTCAGTGG - Intergenic
1091662084 12:2391861-2391883 TGTAAAGTTCAGTTCCTCAGTGG + Intronic
1091957358 12:4657992-4658014 TGTCAGCTACATCTCCTCAGGGG - Intronic
1092935926 12:13364387-13364409 TGTTACCTTCATCTCTTTAGAGG + Intergenic
1097590460 12:61567985-61568007 AGAAAGGGTCCTCTCTTCAGTGG + Intergenic
1101882798 12:108637439-108637461 TGTTAGGTTCCTCTCTACACTGG + Intergenic
1105844059 13:24279663-24279685 TGTATGTTTTATCTATTCAGAGG - Intronic
1111170302 13:84518489-84518511 TTTAAGGTACATCACCTCAGGGG - Intergenic
1112694955 13:101937509-101937531 AGTAAGGTTGATTTCTTCTGAGG - Intronic
1114368698 14:22060118-22060140 TGAAAGGTTCAAGACTTCAGTGG + Intergenic
1114891755 14:26933335-26933357 TATAAGTTTCATCTTTTCAGAGG + Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1116006215 14:39294530-39294552 AGAAAAGTTCATCTTTTCAGTGG + Intronic
1116658453 14:47677791-47677813 TATAATGCTCATCTCTGCAGAGG + Intergenic
1117769514 14:59118899-59118921 TCTAAGGCTCACCTCTACAGCGG + Intergenic
1118055914 14:62079717-62079739 GGTAAGGATCATGCCTTCAGAGG + Intronic
1118135968 14:63028042-63028064 TGTAAGGTACACCCCTTCATTGG - Intronic
1118904391 14:70013053-70013075 TGTAAAGTTCACATCTACAGGGG - Intronic
1121261437 14:92569151-92569173 TGTAAGTTTCATCTCTTCTGGGG + Intronic
1122298094 14:100716807-100716829 AGTAAGGTTCCTCTCATCACAGG + Intergenic
1125871794 15:43108825-43108847 TGTAAGGTTCATCCATGCTGTGG - Intronic
1128774301 15:70308077-70308099 TCTCAGGCTCATCCCTTCAGTGG + Intergenic
1128902234 15:71434938-71434960 TGTATGATTCATCTCTAAAGAGG + Intronic
1131880470 15:96857141-96857163 TGTCAAGTTCATGTCTTCAAAGG + Intergenic
1131987469 15:98059745-98059767 TGTAAGGTTCCTCTCTTCTCTGG + Intergenic
1133244360 16:4437855-4437877 AGTCAGGTTCATCACTTGAGGGG + Intronic
1134227073 16:12399522-12399544 TGGAAAGAGCATCTCTTCAGAGG + Intronic
1137569343 16:49554822-49554844 TGTAAGATTTATATCTTCAGAGG - Intronic
1145814412 17:27785165-27785187 AGCAAGGTACATCTCTTCTGTGG + Intronic
1145837982 17:27969185-27969207 GGTAAGGGGCATCTATTCAGGGG - Intergenic
1151665644 17:75543857-75543879 TGAAAGGATGAACTCTTCAGGGG + Intronic
1156215282 18:34991630-34991652 AGTTAGGTTCATCTCTTTTGTGG + Intronic
1156570946 18:38252430-38252452 TGTAAGACTGATTTCTTCAGTGG + Intergenic
1156687652 18:39669371-39669393 TGTAGGGTTGATTTCTTCTGAGG + Intergenic
1157917078 18:51675645-51675667 TATAAGTTTTATCTCTTCTGGGG - Intergenic
1158871877 18:61696127-61696149 TGTAAGGTACATCTCTTTACTGG - Intergenic
1159419630 18:68200742-68200764 TGTAATGTTCATCCATTAAGAGG + Intergenic
927604214 2:24471743-24471765 TGTAAGGTTCATGTGGGCAGGGG - Intergenic
929529604 2:42739975-42739997 TGAAAGGTTCAGGACTTCAGTGG - Intronic
931011334 2:57917966-57917988 GGTAAGGTTGATCATTTCAGAGG + Intronic
933056584 2:77677590-77677612 TGTAAGTTTAAACTCTTAAGTGG + Intergenic
933721057 2:85398120-85398142 GGTCAGGTTCATCTGTCCAGTGG + Exonic
933770469 2:85741024-85741046 TCTAAAGTTCAGCTCCTCAGTGG + Intergenic
933926660 2:87098394-87098416 TGTAAGTTTAAACTCTTAAGTGG + Intergenic
934257510 2:91440166-91440188 GGCAAGGGTCATTTCTTCAGAGG + Intergenic
936342431 2:111646129-111646151 TCTAACTTTCTTCTCTTCAGAGG + Intergenic
938723325 2:134085486-134085508 ACTAAGTTCCATCTCTTCAGTGG - Intergenic
941175892 2:162196972-162196994 TTTATTCTTCATCTCTTCAGTGG + Intronic
945926441 2:215810400-215810422 TCTTAGGTTGATCTTTTCAGAGG - Intergenic
946415230 2:219536879-219536901 TGTTAGCTTCATCTTTTGAGGGG - Intronic
947073928 2:226320554-226320576 TGTAAGGCTTTCCTCTTCAGTGG + Intergenic
1169107910 20:3013042-3013064 TGTAAGGTTCTTCTTTTGAGGGG - Intronic
1172471446 20:35199957-35199979 TGAGAGGTTCAAGTCTTCAGTGG + Intergenic
1173841713 20:46161623-46161645 TATAAGGTTCCTCTACTCAGGGG + Intergenic
1177759364 21:25385553-25385575 TCTCTGTTTCATCTCTTCAGAGG - Intergenic
1179772193 21:43629638-43629660 TGAAGGGTTCATGACTTCAGTGG + Intronic
1180887972 22:19261611-19261633 TGTGAGGTTCAGGACTTCAGTGG + Intronic
1182039470 22:27225185-27225207 TGTCCGTTGCATCTCTTCAGGGG + Intergenic
1184488680 22:44796557-44796579 TTGAAGCTTCATTTCTTCAGTGG - Intronic
949228557 3:1723201-1723223 AGAAACGTTCTTCTCTTCAGTGG - Intergenic
951792729 3:26504345-26504367 TGGAAGCTTCCTCTTTTCAGGGG + Intergenic
953799942 3:46015103-46015125 TGTCAGGTTCATTCCTTCTGGGG + Intergenic
955461868 3:59192062-59192084 TGTGAGATTGATGTCTTCAGAGG - Intergenic
960547255 3:118930061-118930083 TAAAAGGTTAATCTTTTCAGAGG - Intronic
961732964 3:128980883-128980905 TGAAGGGTTCAAGTCTTCAGTGG - Intronic
962626491 3:137230756-137230778 TGTAAGAATCACCTCTCCAGGGG + Intergenic
963015835 3:140823111-140823133 TCTAAAGTGCATCTCATCAGGGG + Intergenic
963066434 3:141268348-141268370 TATTCTGTTCATCTCTTCAGTGG - Intronic
967851711 3:194087600-194087622 AGCAAAGTTCATCTCATCAGAGG - Intergenic
970649921 4:18166241-18166263 TTTAATGTTCATCTTTCCAGGGG - Intergenic
972952227 4:44341724-44341746 TGTAGGGTTCAAAACTTCAGTGG - Intronic
975369869 4:73572595-73572617 ATTAAGCTTCATCTCTTCAAAGG + Intronic
976330214 4:83822997-83823019 TTTAAAGTCCATCTATTCAGAGG - Intergenic
979110805 4:116753585-116753607 TGCAAGGTTTATCTGTTCTGGGG + Intergenic
979570980 4:122224400-122224422 TTTATTGTTCATCTCTGCAGGGG + Intronic
980252072 4:130330375-130330397 TGTTAAGTTTGTCTCTTCAGAGG - Intergenic
982345056 4:154348318-154348340 TGTCAGGTTCAGGTCTTCAAGGG - Intronic
983190514 4:164749300-164749322 CGTAAGTTTAATCTCATCAGAGG - Intergenic
985713006 5:1440789-1440811 TGTAGGGTTGATTTCTTCTGAGG - Intronic
988231921 5:28490475-28490497 AGTAAGGTTGATTTCTTCTGAGG + Intergenic
988542825 5:32127545-32127567 TTAAAAATTCATCTCTTCAGTGG + Intronic
989259327 5:39401557-39401579 TCTAATGTTCATTTCTTCATTGG + Intronic
990726576 5:58762311-58762333 TGTTAGTATCATCTCGTCAGTGG + Intronic
990797748 5:59563811-59563833 TGTAATGTGCATCTCTTCTTAGG - Intronic
991133484 5:63154047-63154069 TTGAAGGTTGATCTCTTCAATGG - Intergenic
992744860 5:79809552-79809574 TTTAAGGTTGACCTTTTCAGTGG - Intergenic
993252139 5:85541911-85541933 TGTAAGCTTTGTCTCTTCACAGG + Intergenic
994431327 5:99665406-99665428 TTGAAGTTTCATCTATTCAGGGG + Intergenic
995135192 5:108673025-108673047 TGTAAGTTTTACCTCTGCAGAGG + Intergenic
997084105 5:130776059-130776081 TGCCAGATTCATCTCTTCAAAGG - Intergenic
998831256 5:146162039-146162061 TGAAAGGTTCAAGACTTCAGGGG - Intronic
1000879075 5:166676394-166676416 TGTAAAGTTCAGCTGTTTAGGGG + Intergenic
1005855565 6:29860139-29860161 TGCAGGGTTGATCTCTTCTGAGG - Intergenic
1006658272 6:35615908-35615930 TGAAAGGCACATCACTTCAGTGG + Intronic
1008647193 6:53527038-53527060 TGTAGGTTTCTTCTCTTCAGAGG - Intronic
1012392713 6:98761300-98761322 TGAAGGGTTCAAGTCTTCAGTGG + Intergenic
1013153733 6:107472964-107472986 TATTAGGTTCATGTCTTAAGAGG - Intergenic
1015775227 6:136807152-136807174 TGTTGGGTTCATCCCATCAGGGG + Intergenic
1016406648 6:143738393-143738415 TTTTAGGTTGATCTTTTCAGGGG - Intronic
1017654879 6:156618042-156618064 TGTAAGGATCAAGTCTTCTGGGG + Intergenic
1021428870 7:20537053-20537075 TGCAAGGTTCATCTCATAAGAGG - Intergenic
1024806822 7:53151604-53151626 TGCAAGGGGCATTTCTTCAGAGG - Intergenic
1028349569 7:89828839-89828861 TGAAAGGTTCAAGACTTCAGTGG + Intergenic
1029630463 7:101747141-101747163 TGTAAGTTTCATGGTTTCAGGGG + Intergenic
1031587518 7:123550584-123550606 TGTATGGTTTGTCTTTTCAGAGG - Exonic
1032923745 7:136578266-136578288 TGTAGGGTTTATCTCCTCAAAGG + Intergenic
1037218449 8:16486624-16486646 TGTGAGGTTCAAGACTTCAGCGG - Intronic
1037612495 8:20488076-20488098 TGCCTGGTTCATCTCTTCAAGGG + Intergenic
1041237213 8:55816237-55816259 TGAAAGGTTTCTCTCTTAAGTGG + Intronic
1042110391 8:65375606-65375628 TGTATGGTGCATTGCTTCAGAGG + Intergenic
1042573352 8:70191522-70191544 TGTAAGGTTCATCTCTTCAGAGG - Intronic
1046528774 8:115417043-115417065 TTTAATATTCATCTCTCCAGAGG - Intronic
1047354016 8:124103124-124103146 TGTTAGGGTCATCTCTCCACAGG + Exonic
1048479348 8:134773706-134773728 TGAAAGGTTCAAGCCTTCAGTGG + Intergenic
1048896854 8:139000127-139000149 AGAAAGGCACATCTCTTCAGTGG - Intergenic
1052479129 9:28999304-28999326 TGTAAGCTTCATTTCTCCAGGGG + Intergenic
1055739091 9:79366211-79366233 TGGAAGGTTTAGCTCTTCCGAGG - Intergenic
1055980825 9:81998294-81998316 TGCAAGGTTTCTATCTTCAGAGG + Intergenic
1056959264 9:91107650-91107672 TGAAAGGTTTAACACTTCAGTGG - Intergenic
1060135298 9:121147776-121147798 TCTAAGATTCTGCTCTTCAGGGG - Intronic
1060317506 9:122526481-122526503 TGCAATGTCCTTCTCTTCAGAGG + Exonic
1060459771 9:123839704-123839726 TGTAAGGTGGAACTCTTCACAGG - Intronic
1061813978 9:133182197-133182219 TGGAAGGTTCAGCTTTGCAGCGG + Intergenic
1185767259 X:2735751-2735773 TCGAATGTTCTTCTCTTCAGGGG + Intronic
1193765149 X:85519124-85519146 TATAATTTTGATCTCTTCAGTGG - Intergenic
1195981051 X:110578748-110578770 TGTAGGTTTCTACTCTTCAGGGG + Intergenic
1199543313 X:148981516-148981538 TATAAGAGACATCTCTTCAGTGG - Intronic
1201439892 Y:13996158-13996180 TGAAAGGTTAATCACTACAGGGG - Intergenic
1201444679 Y:14046550-14046572 TGAAAGGTTAATCACTACAGGGG + Intergenic
1201475623 Y:14378012-14378034 TGTAAGTTTAATCTCATCAGAGG + Intergenic