ID: 1042574755

View in Genome Browser
Species Human (GRCh38)
Location 8:70205625-70205647
Sequence CTCCTTCTGGGTCTTCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042574755_1042574760 17 Left 1042574755 8:70205625-70205647 CCAAACAGAAGACCCAGAAGGAG 0: 1
1: 0
2: 1
3: 33
4: 279
Right 1042574760 8:70205665-70205687 GCCTGAGCCAGTGTATGTCATGG No data
1042574755_1042574763 19 Left 1042574755 8:70205625-70205647 CCAAACAGAAGACCCAGAAGGAG 0: 1
1: 0
2: 1
3: 33
4: 279
Right 1042574763 8:70205667-70205689 CTGAGCCAGTGTATGTCATGGGG No data
1042574755_1042574762 18 Left 1042574755 8:70205625-70205647 CCAAACAGAAGACCCAGAAGGAG 0: 1
1: 0
2: 1
3: 33
4: 279
Right 1042574762 8:70205666-70205688 CCTGAGCCAGTGTATGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042574755 Original CRISPR CTCCTTCTGGGTCTTCTGTT TGG (reversed) Intronic
901162689 1:7192149-7192171 CTGGTTCTGGCTCTTCTGGTTGG + Intronic
901396036 1:8982336-8982358 CTCCTTATGATTTTTCTGTTGGG - Intergenic
905065963 1:35183145-35183167 CTCCTTGTGCTACTTCTGTTGGG - Exonic
905545035 1:38790899-38790921 CTTCTTCTTGGTCTTCTATATGG - Intergenic
907436558 1:54453182-54453204 CTCCTTCTGGGACTTCCCATTGG - Intergenic
908890733 1:68844638-68844660 CTGCTTCTGGGGCTTCTGTGGGG - Intergenic
908919005 1:69167887-69167909 TTCTTTCTGAGTCTTCTATTTGG - Intergenic
910016603 1:82533071-82533093 GCCATTCTGTGTCTTCTGTTTGG + Intergenic
910334906 1:86117036-86117058 CTCCTACTGGCTCTTATTTTTGG - Intronic
910868500 1:91809794-91809816 CTGCTTCAGGTGCTTCTGTTAGG + Intronic
912961314 1:114198073-114198095 CTCCTTCTGGGTGTTGGGCTGGG - Intergenic
915043193 1:152985475-152985497 CTTCTGCTTGGTCTTCTGCTGGG - Exonic
915047734 1:153032590-153032612 CTTCTGCTTGGTCTTCTGCTGGG - Exonic
915281352 1:154824451-154824473 CCCCATCTGGGTCTTGTGGTTGG - Intronic
916056902 1:161074216-161074238 CTATTTCTGGGTCATCTGCTGGG + Exonic
917442195 1:175077938-175077960 CTCATTCTGGGTTTTCTCTAGGG + Intronic
917834990 1:178934387-178934409 CAACTTCTGGCTCTTTTGTTAGG - Intergenic
918068558 1:181118430-181118452 CTTCTTCTGGGTCACCTCTTAGG - Intergenic
918368343 1:183833443-183833465 CTTGTTCTGGGTCTACTGATCGG + Intronic
919279817 1:195475198-195475220 CTATTTCTGGGTCCTCTATTTGG - Intergenic
920647750 1:207815763-207815785 CTCCTTCTGGCTTTTCTGTGTGG - Intergenic
920988638 1:210914690-210914712 CTCCTTCTAGTTCTTCTGCTGGG - Intronic
922237648 1:223733999-223734021 CTCCTCCTGAGTCTGCAGTTGGG - Intronic
923054258 1:230413711-230413733 CTCCTGCTGGGTGTTCCCTTAGG + Intronic
923635771 1:235694526-235694548 CTACTTCTGGGTATTCTGCTAGG - Intronic
1062927738 10:1329606-1329628 CTCCATCTGGGTCCTCTAGTGGG + Intronic
1065622641 10:27599431-27599453 CTCCCACTGGGTCTTTTGGTGGG + Intergenic
1065662700 10:28022166-28022188 CTCCTCCTGGGCTTGCTGTTGGG - Intergenic
1065693025 10:28354590-28354612 CTCCTTCTTGGTATTCAGCTTGG + Intergenic
1065811926 10:29450509-29450531 CTCCTTCCAGATCTTCTCTTTGG + Intergenic
1065959854 10:30725648-30725670 CTCCTTCCAGATCTTCTCTTTGG - Intergenic
1065992431 10:31025664-31025686 TTTCTTCTGGGTGTTCTTTTGGG + Intronic
1066018586 10:31273576-31273598 CTGCTGCTGGGTAGTCTGTTTGG + Intergenic
1066579045 10:36859932-36859954 GTCCTGCTGGGTGTTGTGTTTGG - Intergenic
1068195345 10:53708943-53708965 TTCCATCTGAGTCTTCTCTTTGG - Intergenic
1068297011 10:55084252-55084274 TTCTTTCTGTGTCTTCTATTTGG - Intronic
1068668284 10:59698611-59698633 CTCCTCCTGGGTCTTTTCCTTGG - Intronic
1068939751 10:62669273-62669295 CTACTTCTGGGACTTCAGCTTGG + Intronic
1069756555 10:70777321-70777343 CTCCTTCTGCTCCTTCTGCTGGG + Exonic
1070448463 10:76532352-76532374 AACCTTCTGGGCCTTCTGTTTGG + Intronic
1071254607 10:83860370-83860392 TTTCTTCTGGTTCTTATGTTGGG + Intergenic
1073687337 10:105769756-105769778 CTCCTACTGGATTTTCTGTCGGG - Intergenic
1076365294 10:129917942-129917964 CCCATTCTGGGTCCTCTGGTAGG - Intronic
1077121034 11:908619-908641 CTCCTTCTCTGTCTTCTGGGTGG + Intronic
1078491386 11:11772389-11772411 CTTGTGCTGGGTCTTCTGGTAGG - Intergenic
1078501228 11:11879576-11879598 CTCCTCCTGGCTCATCTGTTTGG + Intronic
1078928289 11:15893636-15893658 CTCCTTCTAAGTATGCTGTTAGG - Intergenic
1079341535 11:19615891-19615913 CTCCGTCTGAGTCCACTGTTGGG + Intronic
1080155340 11:29104379-29104401 ATCCTTCTAGGTATTCTTTTGGG - Intergenic
1080237614 11:30090036-30090058 CTTCTTCTGTCTATTCTGTTGGG - Intergenic
1080995314 11:37593045-37593067 CTACATCTGGGTCTTCAGCTAGG + Intergenic
1081210543 11:40328536-40328558 CTCTTTCTGGGACTTCTCTAAGG + Intronic
1082073876 11:47961535-47961557 CTCCTTCTGGGTTCTCTCATTGG + Intergenic
1082575362 11:54797346-54797368 CTCCTTCTAGTTCTTATCTTTGG + Intergenic
1082792941 11:57359701-57359723 CTCCTTTTGGCTCCTCTCTTAGG + Intronic
1082797700 11:57389910-57389932 TTACTTCTGGCTCTTCTATTTGG - Exonic
1083154051 11:60811526-60811548 CTCTGTCTGGTTCTTCTGCTTGG + Intergenic
1089030585 11:115323980-115324002 CTCCTTCTGGGTTCTTTGTATGG - Intronic
1089132398 11:116222932-116222954 GACCTTCTGGGTCTTCTTTGGGG + Intergenic
1089507342 11:118972323-118972345 CCTCTTCTGGGTCTTCTCCTTGG + Intronic
1090655901 11:128845340-128845362 AACCTTCTGGGTCTCCTCTTTGG - Intronic
1090710738 11:129382675-129382697 CTCATTTTGCATCTTCTGTTGGG + Intronic
1092137656 12:6160928-6160950 ATCGTTCTGGGTGCTCTGTTGGG + Intergenic
1093393280 12:18649885-18649907 CTCCTTCTTAGTCTTCTGTGTGG + Intergenic
1095363275 12:41370664-41370686 CTTCTTCTGGAACTTCTTTTAGG + Intronic
1095881509 12:47141886-47141908 CTCCTCCTGGGTCCTTTGGTGGG - Intronic
1096421212 12:51459493-51459515 CTCCTTCTGGGGTTTTTGTAAGG + Intronic
1098465235 12:70779444-70779466 CTCCTTCTGGTTGTTCAGCTCGG + Intronic
1099273931 12:80551148-80551170 CTCCAACTAGGTCTTCAGTTGGG - Intronic
1100445352 12:94655130-94655152 CACCATCTGGGTCTCCTTTTGGG + Intergenic
1100622883 12:96297161-96297183 CTTCTTCAGGGTTTTCTGTTTGG - Intronic
1101568931 12:105935397-105935419 CTACTTCTGGATATTGTGTTAGG + Intergenic
1101629707 12:106481072-106481094 CTCCTTGCTGGTCTTCTATTAGG - Intronic
1101814057 12:108131597-108131619 CTGCTTTTGGGTCTTGTGTGGGG + Intronic
1102039934 12:109794233-109794255 ATCCTTCTGGGTCCCCTGTAGGG - Intronic
1102991699 12:117320803-117320825 CTCCTGCTGTGTCTTCTGCTAGG + Intronic
1103690201 12:122766337-122766359 CTCCTCCTTAGTCTTCTGTGCGG + Intronic
1107198431 13:37683222-37683244 CCCCTGCTGGGGCATCTGTTTGG + Intronic
1110648811 13:77919330-77919352 CTTATTCTGGGGCTTCGGTTTGG - Intronic
1115885325 14:37965208-37965230 TTACTTCTGGGTTTTCTATTTGG + Intronic
1116203267 14:41825990-41826012 CTTCCTGTGAGTCTTCTGTTAGG + Intronic
1116503492 14:45649843-45649865 CTCCTTCTGGATCTTCAGCGGGG + Intergenic
1116757729 14:48968743-48968765 GTGGTTCAGGGTCTTCTGTTAGG - Intergenic
1118918907 14:70132105-70132127 CTCTTTCTGTGGCATCTGTTTGG + Intronic
1120107421 14:80512541-80512563 GTCATTCTGTGTCTTCTGATTGG + Intronic
1120396686 14:83975954-83975976 CTCTTCCTGGGTTTTCTCTTGGG - Intergenic
1120718393 14:87864908-87864930 CTCCTTCTGTGTACTCTCTTGGG - Intronic
1122103608 14:99434049-99434071 TTTCTTCTGGGTATTCTCTTGGG - Intronic
1124438695 15:29671764-29671786 GTCCTTGTGGGCTTTCTGTTTGG + Intergenic
1124587205 15:31020809-31020831 CTCTGTCTTGGTCTTCTGGTAGG + Intronic
1124635372 15:31361545-31361567 CTCCTTCTGTGTCTCCTGGGGGG - Intronic
1126297124 15:47152597-47152619 CCCCTTCAGGATCTTCTGTATGG + Intergenic
1126361441 15:47850497-47850519 CTCATGCTAGGTATTCTGTTGGG + Intergenic
1129085541 15:73086249-73086271 CTACTTCTGTGTTCTCTGTTTGG + Intronic
1130041362 15:80407414-80407436 CTCCTTCAAGGTCCCCTGTTGGG + Intronic
1130625186 15:85507067-85507089 CTCTTTCTTTATCTTCTGTTAGG + Intronic
1131062023 15:89410272-89410294 CTTCTCCTTGGTCTTCTGTGGGG - Intergenic
1131330011 15:91488546-91488568 CTCCTTCTGGGTGTGATATTAGG - Intergenic
1132986866 16:2771861-2771883 CTCCTTTTGGGGCTTGTGCTTGG - Intronic
1133146447 16:3790673-3790695 CTCGTTGTGGTTCTTCTGTAGGG + Intronic
1133257902 16:4529277-4529299 CTCCTGCTGGGTCTCCTGGCGGG - Intronic
1133316846 16:4890181-4890203 CACCTTCTGGTTCTTCAGCTTGG + Exonic
1133477943 16:6141416-6141438 CTCCCCCTGGGTTATCTGTTAGG + Intronic
1134088850 16:11378927-11378949 TTCCTTCTTGATCTTCTGTCTGG + Intronic
1135122477 16:19778322-19778344 CTCCCTGTGGGCCTTCTGTGGGG + Intronic
1138617831 16:58185258-58185280 CTGCTACTGGGGCTGCTGTTTGG - Intronic
1139542562 16:67629126-67629148 CCTGTTCTGGGTCTTCTCTTGGG + Intronic
1139695253 16:68669694-68669716 CTCCTTCTGGGTTACCTGGTGGG + Intronic
1140271776 16:73472688-73472710 CTCCTTCTGGGCCTTCCCATTGG - Intergenic
1144729431 17:17518077-17518099 CTCCCTCTGGGTCTTCTGAGGGG - Intronic
1145786726 17:27598430-27598452 CTTCTCCTGGGACTTCTTTTGGG + Intronic
1146891001 17:36506507-36506529 TTCCTCCTGGGTCTTCTCTTTGG + Exonic
1146893135 17:36521500-36521522 CTCCTTCTGGAACTTCTGTGAGG - Intronic
1147165787 17:38592486-38592508 GTCCTTCTGCCTGTTCTGTTTGG - Intronic
1147548711 17:41422811-41422833 CTCCTTCAGGGACTCCTGCTGGG + Exonic
1147550668 17:41439236-41439258 CTCCTTCAGGGACTCCTGCTGGG + Exonic
1150031864 17:61746784-61746806 TTCCTTGTTGATCTTCTGTTTGG - Intronic
1150389485 17:64781960-64781982 CGCCTTGGGGGTCTTCTGTTTGG + Intergenic
1150624002 17:66829813-66829835 CTCCATCTGGGGCTTTTATTGGG + Intergenic
1151193738 17:72416924-72416946 CTCCTTCTAGGTCCACTTTTAGG + Intergenic
1151376082 17:73690069-73690091 CTGGCTCTGGGTCTCCTGTTTGG + Intergenic
1152326460 17:79642712-79642734 CTCCTTCTCGGCCTTCTTTGTGG - Intergenic
1152643151 17:81457548-81457570 CTTCTTCTTGGCCTTCTGGTTGG - Exonic
1153742240 18:8140765-8140787 CTTCTTGTGTGTATTCTGTTAGG - Intronic
1156229560 18:35140300-35140322 CTGCTTCCGGCTCTTCTGTGTGG - Exonic
1156837652 18:41574573-41574595 CTCCTGCTGGGTCTTAGTTTTGG - Intergenic
1157559743 18:48637890-48637912 CTCCTTCTGGGTTTTATGTGAGG - Intronic
1160054319 18:75464936-75464958 GTTCTTCTGGGTCTTCTGGGTGG - Intergenic
1161237761 19:3206254-3206276 CTCCTGCTGGATCTGCTGTAGGG - Exonic
1165649146 19:37470326-37470348 TTCCTCCTGGCTCTTCTCTTGGG - Exonic
1167570986 19:50288960-50288982 CTTCTATTGGGTTTTCTGTTTGG - Intronic
1167783876 19:51620298-51620320 TTCCTCCTGTTTCTTCTGTTTGG - Intronic
1167820716 19:51925305-51925327 CTCTTTATGGGTGTTGTGTTGGG - Intronic
1168443456 19:56391783-56391805 CTCCTTCTGGTTCCTCTCTTGGG + Exonic
1168499032 19:56877979-56878001 CTCCTTCTGAGGCCTCTCTTTGG + Intergenic
928136199 2:28689389-28689411 CTCCTTCTGGGCCATCATTTTGG + Intergenic
929092552 2:38233881-38233903 CTCCTTCTGCGTATTTTGCTTGG + Intergenic
930053337 2:47233988-47234010 CTCCTTCAGGGTCTTTGGTCTGG + Intergenic
930251363 2:49037817-49037839 CTCTTTCTGGATTTCCTGTTAGG - Intronic
932680635 2:73821659-73821681 CTACTTATGGGTTTTTTGTTTGG + Intergenic
933113804 2:78440442-78440464 CTGCTTCTAGGTCTTCTTTGGGG - Intergenic
933740120 2:85526708-85526730 CTCCTTCTGAGTGTTCCCTTGGG + Intergenic
934777847 2:96950306-96950328 CTCCTTCTGGGCCTTGGGTGGGG + Intronic
935715485 2:105935716-105935738 CTCCTTGTAAGTGTTCTGTTCGG + Intergenic
935786765 2:106556094-106556116 CTACTTCTGTGTTGTCTGTTGGG - Intergenic
936166824 2:110128182-110128204 CTCCTTCTGTTTCTGCTGTCAGG + Intronic
936969124 2:118159377-118159399 TTCCTTATTGGTCTTCTGTATGG - Intergenic
940248579 2:151647662-151647684 CTCCATTTGGGTTTTCTGGTGGG - Intronic
941009984 2:160288462-160288484 CTCCTTCTGGGTGAGCTGTCTGG + Intronic
941022026 2:160418366-160418388 GTCTTTCTGGGTCTTCAGATTGG + Intronic
942668030 2:178343157-178343179 GTCCTACTGGTTCTTCAGTTTGG + Intronic
943845616 2:192642712-192642734 ATCATTCAGGGTCTTGTGTTTGG - Intergenic
943993579 2:194730669-194730691 CTACTTCTGGGGTTTCAGTTGGG - Intergenic
944632940 2:201645261-201645283 CTCCTCCTGAGCCTTCTGTATGG + Exonic
946479535 2:220040803-220040825 CTCCTTCTGGGTCTCCTGTGGGG + Intergenic
947576964 2:231283226-231283248 CTCCTTCTGGAACTCCTATTGGG - Intronic
948015278 2:234684405-234684427 GTGATTCTTGGTCTTCTGTTTGG + Intergenic
948569726 2:238910087-238910109 TTTCTTCTGGGTCTTATGTTTGG + Exonic
948897246 2:240933216-240933238 CTCCTGCTGGAGCTTCTGTGCGG - Intronic
1169391987 20:5198067-5198089 CTCCTCCTCGGTCTTCTTTCTGG + Intergenic
1170499894 20:16963937-16963959 ATCTTGCTGGATCTTCTGTTTGG - Intergenic
1171076366 20:22129347-22129369 CTCCTTATTGGTTTTCTGTCTGG - Intergenic
1172129108 20:32644092-32644114 AACCTTCTGGGTATTCTGTCTGG - Intergenic
1172598975 20:36170613-36170635 CTCCTTTGGGGGGTTCTGTTGGG + Intronic
1173177514 20:40775579-40775601 CCTCTCCTGGGTCTGCTGTTTGG + Intergenic
1173446347 20:43122315-43122337 CTCCCTCTTGGTCCTCTGTCTGG + Intronic
1175329239 20:58151238-58151260 CTCCTTCTCCCTCTCCTGTTGGG + Intronic
1175560755 20:59927541-59927563 CTTCTTTTGGGTATTCTCTTTGG - Intronic
1176553456 21:8241787-8241809 TTACTTTTGGTTCTTCTGTTTGG + Intergenic
1176572378 21:8424811-8424833 TTACTTTTGGTTCTTCTGTTTGG + Intergenic
1176580287 21:8469371-8469393 TTACTTTTGGTTCTTCTGTTTGG + Intergenic
1177867849 21:26534482-26534504 CTTCTCCTTTGTCTTCTGTTTGG + Intronic
1179529187 21:42006899-42006921 CTTCTTCTGAGGCTTCTCTTTGG - Intronic
1179815159 21:43900970-43900992 CTTCTTCTGGGTTTTCTGTATGG - Intronic
1179887405 21:44320122-44320144 CTCCTTGGGGGGCTTCTGGTGGG - Exonic
1180843428 22:18969754-18969776 TTCCTTCTCCGTCTTCTGCTCGG - Intergenic
1180988245 22:19918093-19918115 CGCCCTCTGGGCCTTCTCTTGGG - Intronic
1181941046 22:26477402-26477424 TTCCTGCTGGGTGTTCTCTTAGG - Intronic
1183975983 22:41512641-41512663 CTCCTTCATGGTGTTCTGTAGGG + Intronic
1185068308 22:48642941-48642963 CTCCTTCTGGGACTACTGACAGG - Intronic
1203258454 22_KI270733v1_random:158815-158837 TTACTTTTGGTTCTTCTGTTTGG + Intergenic
949702117 3:6770555-6770577 CTCCTCCTGGTTCCTTTGTTAGG + Intronic
950978947 3:17280876-17280898 CTCCTTCTGGGGCTTCAGGGTGG + Intronic
951936533 3:28028877-28028899 CTCATTTTGGGTCTTCATTTTGG + Intergenic
952796535 3:37243745-37243767 CTCCTTCTGGGTCCGGAGTTTGG - Intronic
953190403 3:40681191-40681213 GTCATTCTGGGTCTCATGTTTGG + Intergenic
953338116 3:42111140-42111162 CTCCTTCTGGACCTTCTGTCTGG - Intronic
953408862 3:42676681-42676703 CTATTTCTGGGTCCTCTGTTCGG + Intergenic
954852820 3:53617880-53617902 CTCCTTACAGGGCTTCTGTTTGG - Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956176790 3:66480606-66480628 TTCTTTCTGGGTGTTCTTTTGGG - Intronic
957127226 3:76177543-76177565 ATCCTGCTGGGTCATCTGGTGGG + Intronic
959926909 3:111932327-111932349 GTCCAGCTGGGTCTTCTGCTCGG - Exonic
960926864 3:122803103-122803125 TTCCTTATGGGTCTTCTGCTGGG - Intronic
960948723 3:122984469-122984491 GTCCGTCTGTGGCTTCTGTTTGG + Intronic
961002610 3:123384185-123384207 CTCCCTCAGGGTCTTTTCTTGGG - Intronic
961459324 3:127040223-127040245 CTCCTTCTCTGTCCTCTGTAAGG + Intergenic
961813019 3:129532561-129532583 CTCCTTCTCTGCCTTCTGTGTGG - Exonic
962060680 3:131923890-131923912 CTCATTCTGGGTCTTACTTTTGG - Intronic
962267644 3:133955096-133955118 CTCCTTCTGGGGGTTCTGGGTGG + Exonic
963154467 3:142080928-142080950 TTCCTTGTGGATTTTCTGTTTGG - Intronic
963451501 3:145487143-145487165 CTGCTTCTGAGCCTTCTTTTTGG + Intergenic
963548456 3:146691980-146692002 TTACTTCTGGGTCTACTATTGGG + Intergenic
964775169 3:160267677-160267699 CTCATTCTGGGTCTCCTTGTGGG + Intronic
964821362 3:160773890-160773912 CTCCTTCTGTGACTTCTCTGTGG + Intronic
967606349 3:191451695-191451717 CTCCTTCAGGATCTGCTGGTGGG + Intergenic
967669482 3:192215626-192215648 CTCCTAGCAGGTCTTCTGTTAGG + Intronic
968664633 4:1814445-1814467 CTCCTTCTCTGCCTTCTCTTTGG + Exonic
968845039 4:3036293-3036315 CTCCTTGTGAGTGTGCTGTTGGG + Intronic
969606503 4:8204761-8204783 GTCCTTCTGTGTCTTCTGACAGG + Intronic
970799218 4:19951969-19951991 CTCCCACTGGGACTTCTGCTGGG - Intergenic
970890521 4:21038889-21038911 CTCCTTCACAGTGTTCTGTTGGG + Intronic
974513655 4:62878693-62878715 TTCCTTCTGGATCTTCTGAAGGG + Intergenic
975947669 4:79727474-79727496 ATCATTCTGAGTCTTCTTTTAGG - Intergenic
977085110 4:92586184-92586206 CTCCTTCTTGGTTTTATTTTTGG - Intronic
978290840 4:107138012-107138034 CTGGTTCTGGGTCATCTATTTGG + Intronic
978720834 4:111907075-111907097 CTCCTTCTGGGACTTCAGAAAGG - Intergenic
980289094 4:130822349-130822371 CTATTTCTGGGTTTTCTATTTGG + Intergenic
981084583 4:140669858-140669880 CTTCTTCAGTGTCTTCTGTATGG + Intronic
982456616 4:155617774-155617796 CTCCCTCATGGTCTTTTGTTAGG - Intergenic
984801924 4:183723548-183723570 CTCCTTCTGTCTGTTCTGTTTGG + Intergenic
984984859 4:185318404-185318426 TTCCTTCTGTGTCTTCAGATAGG + Intronic
985362443 4:189190039-189190061 CTCCAGCTGGTTCCTCTGTTCGG + Intergenic
986808165 5:11328667-11328689 CTCCTTCTGGGCTTTCTCTCAGG + Intronic
987313419 5:16701782-16701804 TTCCTTCTGGCTCTTCTGCAAGG + Exonic
987335273 5:16893238-16893260 CTCCTTATCGCTTTTCTGTTGGG - Intronic
987609476 5:20183022-20183044 CTCCCTCTGGGTCCTCAGTTTGG + Intronic
988266490 5:28958193-28958215 CTCCTTATAGTTTTTCTGTTTGG - Intergenic
988451028 5:31343356-31343378 CTGCTTTTGGATCTTCTCTTCGG - Intergenic
988644582 5:33080304-33080326 ATCTTTCTGGGTTTTCTGGTGGG + Intergenic
989324153 5:40171100-40171122 CCACTTCTGTGTCTTCTTTTGGG - Intergenic
990908879 5:60833774-60833796 CACCTTCTAGGGCTTCTGTGAGG + Intronic
990986356 5:61644239-61644261 CTCCTTCTCAGTCTTCTCTATGG - Intronic
992810517 5:80383189-80383211 GTCCTTCTGTGATTTCTGTTGGG + Intergenic
993851522 5:93015877-93015899 GTACTGCTGGGTCTTCTGCTGGG - Intergenic
994434069 5:99706307-99706329 CCCCTTCTGGGGCTTCGGTGTGG + Intergenic
995358788 5:111269781-111269803 GTACTTGTGGGTCTGCTGTTTGG + Intronic
995832869 5:116373093-116373115 CTCATTCTGGCTCTGTTGTTTGG - Intronic
996424294 5:123295902-123295924 CTGCTTGTGGGTCTACTGTCAGG - Intergenic
996541981 5:124639853-124639875 CTCCTTCTAGGTCTTTTATTTGG + Intronic
997702112 5:135909774-135909796 CTCCTGCTGGGTCCTGTGCTTGG - Intergenic
997702183 5:135910378-135910400 CTCCCTCTCAGTCTTCTGTGGGG + Intergenic
998135622 5:139672913-139672935 GTCCTTCTGGGGCTCCTGTGTGG - Intronic
999166086 5:149550865-149550887 CTCCTTCGGGGACATCTATTTGG - Exonic
999690519 5:154142179-154142201 ATCCTTCTGGGGCTTTTGTCTGG - Intronic
1000400927 5:160826318-160826340 CTCCAGCTGGTCCTTCTGTTCGG - Intronic
1001414148 5:171531746-171531768 TTCCTTCTTTTTCTTCTGTTTGG + Intergenic
1005258380 6:24029856-24029878 CTCCTTCTTCTTCTTCTTTTTGG + Intergenic
1007446132 6:41907517-41907539 CTGCTTCTGGGTCCTCTGGGAGG - Intronic
1008347973 6:50453042-50453064 CTTCTTCTCCTTCTTCTGTTTGG - Intergenic
1009805639 6:68598526-68598548 CTCCTTCTTCTTCTTCAGTTTGG - Intergenic
1010133480 6:72523047-72523069 CTCCTTCTGGGCATTCAGGTGGG - Intergenic
1013997017 6:116320929-116320951 CTCCTTCTTTGCCTTCTGTTAGG - Intronic
1014259832 6:119203676-119203698 CTCCTCCTGGTTCTTCTTCTTGG - Intronic
1020628783 7:10615497-10615519 CTGCTTCAGGGTCTTCAGTCAGG - Intergenic
1020942391 7:14557099-14557121 CTACACCTGGGTTTTCTGTTTGG - Intronic
1021049865 7:15969918-15969940 CTCCTTCTTGGTCTCCTTTGAGG - Intergenic
1022540763 7:31133573-31133595 TTCCTTCTGGGTCCTCTACTTGG + Intergenic
1022955429 7:35375981-35376003 CTTTTTCTGGTTCTTCTCTTTGG - Intergenic
1024360185 7:48460066-48460088 CTCCTTCTAGGTCTTTTTCTAGG - Intronic
1024672499 7:51608727-51608749 CTCCATCTCTGTCTTCTCTTAGG + Intergenic
1024991785 7:55240440-55240462 CTCCTTCTGCCTCTTCTTTTCGG + Intronic
1026105673 7:67418932-67418954 TTCCATCTGTGTCTTCTGCTAGG + Intergenic
1029574086 7:101391494-101391516 GTCCTTCTAGGTCTTCTCTATGG + Intronic
1030516578 7:110545763-110545785 CTCCTTCTGTGTCTCCTATTTGG - Intergenic
1032516785 7:132512383-132512405 CTCATTCTGCATCTTCTATTAGG + Intronic
1033950221 7:146775656-146775678 CTTCTTCTTGTTCTTCTTTTGGG - Intronic
1036406359 8:8458954-8458976 CTCTTTCTTGGTCTTCTTGTGGG - Intergenic
1037877559 8:22555349-22555371 CTCCTGCTGGGTAGCCTGTTGGG - Intronic
1038344227 8:26717523-26717545 CTCCTTATGGTTCTTATGTTTGG + Intergenic
1038396284 8:27247898-27247920 TTCCTTATGTGTTTTCTGTTAGG + Intronic
1038600971 8:28942047-28942069 CTGCTACTGGGTCCTCTGTGAGG + Intronic
1039223418 8:35360858-35360880 CTCCTACTGTGTTTTCTGCTTGG + Intronic
1039646143 8:39285205-39285227 CTCCTTCTGGTCCTTCTCATGGG + Intergenic
1039994232 8:42517736-42517758 CTCCTTCTGGATATTAAGTTGGG - Intronic
1041578142 8:59423352-59423374 CTCCTTCTGAGTAGTCTTTTGGG + Intergenic
1041618388 8:59935156-59935178 CTCCTTCTCAGTCTTCTTTGTGG - Intergenic
1042464288 8:69109187-69109209 CTCTTTCTGCGTTTTCTATTCGG - Intergenic
1042574755 8:70205625-70205647 CTCCTTCTGGGTCTTCTGTTTGG - Intronic
1043397915 8:79856631-79856653 CTCCTTATGGGGCTTCGGTTAGG - Intergenic
1044384555 8:91572095-91572117 CTATTTCTGAGTCCTCTGTTTGG - Intergenic
1045497884 8:102723533-102723555 CTCCTTCTGGGTATCTGGTTTGG - Intergenic
1046569149 8:115940764-115940786 CTCCTTCTGTGGCTTCTATTTGG - Intergenic
1049647877 8:143744327-143744349 CTGCTCCTGGGTTTTCTGGTGGG - Intergenic
1051755220 9:20392323-20392345 CTGCATCTGGGCCTTATGTTTGG - Intronic
1051939913 9:22493144-22493166 CTCCTTCTTGGTTTTGTCTTGGG + Intergenic
1052384026 9:27804230-27804252 CTCCTTCTGGGTCTAAAGATTGG + Intergenic
1055197082 9:73609019-73609041 CTTCTGCTGGATCTACTGTTAGG + Intergenic
1056171203 9:83986494-83986516 CTAGTTCTGGGTCTGCTGTTGGG + Intronic
1056787068 9:89600946-89600968 CTCCTCGGGGGTCCTCTGTTGGG - Intergenic
1058295288 9:103298844-103298866 CTCCTACTGGTTCCTCTGTCTGG - Intergenic
1059346278 9:113631190-113631212 CTCCTTCTGGATCATCTGGAGGG - Intergenic
1060320537 9:122555331-122555353 CTCCTTCTGTCCCTTCTCTTTGG + Intergenic
1060986862 9:127825076-127825098 CTCCTGCTGCGTCTTCTGCCTGG + Intronic
1061293808 9:129666521-129666543 CTCCTCCTCGGTCTTAAGTTGGG + Intronic
1061797261 9:133093725-133093747 TTCCTTATAGATCTTCTGTTTGG + Intergenic
1203474649 Un_GL000220v1:140831-140853 TTACTTTTGGTTCTTCTGTTTGG + Intergenic
1185783202 X:2867010-2867032 CTCCTCCTGGGTCTTGTTCTGGG - Intronic
1186491615 X:9977954-9977976 CTCCTTCTGTCTCTCCTGTGTGG - Intergenic
1187737479 X:22319793-22319815 CTCTGTCTGGGTCTTCTGCTTGG + Intergenic
1187767237 X:22655757-22655779 CTCCTTCTGGGTCTCCAGTCTGG - Intergenic
1189070521 X:37858482-37858504 CTCCTTCTTTGCCTTCTTTTGGG - Intronic
1189201912 X:39203718-39203740 CTCCTTCTGGGACTTCAGAAGGG + Intergenic
1190876700 X:54465237-54465259 CTCCTTCTGAATGTTCTCTTTGG - Intronic
1192013462 X:67300208-67300230 CTGCTTCTGGGTCTTCAATATGG - Intergenic
1194630522 X:96277255-96277277 CTTCTTCTGGGTTTTGGGTTTGG - Intergenic
1195619547 X:106939298-106939320 CTCCTCCTGGCTCTCCTGTTAGG - Intronic
1196789056 X:119447776-119447798 CTCCTTCTCAGTCTTCTTTGTGG + Intronic
1197699762 X:129590232-129590254 TTCCTTCTGGGCTTTCTGCTTGG + Exonic
1198027435 X:132721022-132721044 CTCTTTCTTGGTTTTCTGTCTGG - Intronic
1198878749 X:141255965-141255987 CTCCTTCTTGTTCTAGTGTTAGG + Intergenic
1199568017 X:149236810-149236832 CTTCTTCTGCGTCTGTTGTTAGG - Intergenic
1199579283 X:149345222-149345244 CCCCTGCTGGGTCTCCTGTAGGG - Intergenic
1200072112 X:153534359-153534381 CTCCTTCTGGGGGTGCTGTGTGG - Intronic