ID: 1042579393

View in Genome Browser
Species Human (GRCh38)
Location 8:70260040-70260062
Sequence GTAACTTTGTTTCCTGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042579393 Original CRISPR GTAACTTTGTTTCCTGGTAG TGG (reversed) Intronic
901354926 1:8637192-8637214 GTGACTTTGTCTGCTGCTAGGGG - Intronic
901943727 1:12684004-12684026 GTAACTTTGATTCCTGTGTGTGG - Intergenic
907277612 1:53326076-53326098 GAGAGTTTGTTTCCTGGAAGGGG - Intronic
910633539 1:89382274-89382296 GAATCTTTGTTTCCTGGGAAAGG - Intronic
910752523 1:90649125-90649147 GTAACTTTGTTTTCTATTCGAGG + Intergenic
912869127 1:113287832-113287854 GTAAGTTTGGATCTTGGTAGAGG + Intergenic
914698384 1:150107349-150107371 ATAACTTTGTTTTCTGGTTTTGG - Intronic
923005049 1:230042644-230042666 GTTACTTTGTCTCCTGATAATGG + Intergenic
924309965 1:242730852-242730874 GGAACTTTCTTGCCTGATAGCGG - Intergenic
1063504484 10:6583551-6583573 ACACCTTTGTTTCCTGGAAGAGG + Intergenic
1063772769 10:9222829-9222851 GTAACCTTGTTTCCCATTAGTGG + Intergenic
1064274154 10:13891596-13891618 GTGTCTTTGTTTCCCGGTCGCGG - Intronic
1067424720 10:46197976-46197998 GCAAATTTGTTTCCTGGTAAGGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1069922070 10:71821844-71821866 GTCACTTTGTGTCCTGGTCAGGG - Intronic
1070166952 10:73906183-73906205 CTAACTTTGGTTCCTGGTGAGGG + Intergenic
1070861201 10:79664214-79664236 GCAAATTTGTTTCCTGGTGAGGG + Intergenic
1070876052 10:79811383-79811405 GCAAATTTGTTTCCTGGTGAGGG - Intergenic
1071642985 10:87333515-87333537 GCAAATTTGTTTCCTGGTGAGGG - Intergenic
1073948732 10:108783309-108783331 GTAACTTGGTATCCTGGATGAGG - Intergenic
1075249815 10:120856898-120856920 GAAACTTTGTTTGCTCCTAGGGG + Intronic
1078209698 11:9260648-9260670 TTAATTTTGTTTTCTGGTTGAGG - Intronic
1080831656 11:35899151-35899173 GTAACTTTTTTTCTTAGTAGTGG - Intergenic
1081270562 11:41077602-41077624 GAAAATTTGTTTCCTGGTTTGGG - Intronic
1085902273 11:80715386-80715408 GTAATTTATTTTCCTGGTATTGG - Intergenic
1088134182 11:106533853-106533875 GTCACTTTCTTTCATGGTAGTGG + Intergenic
1088225240 11:107612945-107612967 TTATCTTTGTTTCCTGTTTGGGG + Intronic
1090423725 11:126592924-126592946 GTACCTTTCTTTCCTGTGAGGGG + Intronic
1090686343 11:129126015-129126037 GTAACTTTGTTTCAAGATAGAGG - Intronic
1092198144 12:6562539-6562561 GTTACTTTATTTCCTAGAAGTGG + Intronic
1092601845 12:10075248-10075270 CTAACTTTGTTCCCTGAGAGGGG + Intronic
1095590540 12:43898242-43898264 GTGACTTTATTTCCTGTTAATGG + Intronic
1097151046 12:56980120-56980142 TTAACTTGTTGTCCTGGTAGGGG + Intergenic
1098214102 12:68197697-68197719 GTAATTTTGTTTGCTGCTTGAGG - Intergenic
1100438484 12:94593717-94593739 TTACCACTGTTTCCTGGTAGAGG - Intronic
1102127711 12:110498578-110498600 ATAACTCTGTGTCCTGGTAACGG - Intronic
1106707759 13:32300063-32300085 GTAACTTTGTTTCCTATTTGAGG + Intergenic
1107951257 13:45464519-45464541 GTAAATTAGTTTTCTAGTAGGGG + Intergenic
1108051585 13:46446958-46446980 GAAAATTTGTTTCCTGGGAAAGG + Intergenic
1109544139 13:63820581-63820603 GAAAATTTGTTTCCTGGGAAAGG + Intergenic
1109556673 13:63985089-63985111 GTAACCTTGTGTCGTGCTAGCGG - Intergenic
1110042596 13:70783020-70783042 GTGATTTTTTTTCCTGGTCGTGG + Intergenic
1111055564 13:82945111-82945133 GTAACTTTGTGTCTTGGAGGTGG - Intergenic
1114174510 14:20308058-20308080 GTAACTTTATGTCCTGTTAGAGG - Intergenic
1114655817 14:24315017-24315039 GTAAGTAAGTTTCCTGGGAGCGG + Exonic
1117219465 14:53587809-53587831 GGAACTCTGTTTCCTTTTAGTGG - Intergenic
1121055835 14:90851712-90851734 GTAACCTTGTTTTCTTCTAGAGG + Exonic
1122531510 14:102430834-102430856 GTAATTAAGTTTCCTGGAAGAGG - Intronic
1124667868 15:31609344-31609366 CCAAGTTTGTTTCCTGGCAGTGG - Intronic
1124907513 15:33885104-33885126 GTAACTTGGTGTCCTGGTTGAGG - Intronic
1125846065 15:42855359-42855381 GTAACTCTGTTTCCTTGTATTGG - Intronic
1126689526 15:51278416-51278438 GAAACTTTGGCTCCTCGTAGGGG + Intronic
1128788795 15:70417557-70417579 GTGACTTTGTCACCTGGTAAAGG - Intergenic
1129562796 15:76589551-76589573 CTAAGTTTGTTTCCAGGCAGTGG + Intronic
1136131543 16:28225130-28225152 GTAACTTCGTTCCCAGGAAGAGG + Intergenic
1139244083 16:65423813-65423835 GAAATTCTGTTTCTTGGTAGGGG + Intergenic
1143121176 17:4607944-4607966 GTCTCTCTGTTTCCTGGCAGTGG - Exonic
1143126437 17:4643812-4643834 GTAACTGTGATTGCTGGGAGTGG - Intergenic
1144546309 17:16199265-16199287 GTAAATTTGTATGCTAGTAGGGG - Intronic
1145190411 17:20837315-20837337 GCAACTTTGCTGCATGGTAGTGG - Intronic
1149836616 17:59918770-59918792 GTCACTTTGTTCCATGTTAGAGG + Intronic
1150031471 17:61740808-61740830 GTCACTCTCTTTGCTGGTAGAGG + Intronic
1152173015 17:78766120-78766142 GAAGCTTTGTCTCCTGCTAGAGG - Intronic
1153698203 18:7665089-7665111 GTGAATGTATTTCCTGGTAGGGG + Intronic
1156470595 18:37375256-37375278 GTAACTTTGTGTGTTGGGAGGGG + Intronic
1156706824 18:39892701-39892723 GTATTTTTATTACCTGGTAGTGG - Intergenic
1159583293 18:70258462-70258484 ATTACTTTGTTTCCTGGAAAGGG + Intergenic
1162372941 19:10289889-10289911 GTAACTTGGTTTCCAAGGAGGGG - Intergenic
1164217650 19:23163789-23163811 ATCACTTTGCTTCCTGGTTGGGG + Intergenic
1164523332 19:28995478-28995500 GTAACTTTCATTGCTGGTGGAGG + Intergenic
1167744415 19:51342209-51342231 GTAGCTTAGCTTCCTGGGAGGGG + Intergenic
927650242 2:24908631-24908653 GTGACTGTGTTACCTGGTTGGGG - Intronic
929281086 2:40079741-40079763 GTAATGTTGTTTTCTGATAGAGG - Intergenic
930593869 2:53361848-53361870 GTTGTTTTGTTTCCTTGTAGCGG + Intergenic
930606483 2:53498508-53498530 TTACCTTTGTATCCTGGAAGGGG - Intergenic
931951567 2:67369254-67369276 ATAACTCTGTCTCCTGGTATTGG + Intergenic
933017224 2:77143454-77143476 TTTACTTTCTTTCTTGGTAGTGG + Intronic
934868464 2:97836829-97836851 GTTACTTTCTTTCCATGTAGTGG + Intronic
935356726 2:102208246-102208268 TTAACTTGGTGTCCTTGTAGGGG + Intronic
936717797 2:115209733-115209755 GAAACTGTGTTTCCTGGGAGAGG + Intronic
938619108 2:133031072-133031094 TTAACTTGGTGTCCTTGTAGGGG - Intronic
942366327 2:175231980-175232002 GAAACTTTTTTTTTTGGTAGAGG + Intergenic
942426219 2:175863462-175863484 GTTAATTTGTTCCCTGGGAGGGG - Intergenic
942555911 2:177172187-177172209 GTAACTTTGTCTTTTGGCAGAGG + Intergenic
945595881 2:211791402-211791424 GTTACTTTATTTCATGTTAGTGG - Intronic
946968195 2:225062513-225062535 GTATCTTTTTTTCCTTGTTGTGG + Intergenic
1172411406 20:34726290-34726312 GTAGATTTATTTCTTGGTAGTGG + Intronic
1175526365 20:59637162-59637184 GTACCTTTGTTTCCTGTATGGGG + Intronic
1176650683 21:9544176-9544198 GTAAATTTGTATGCCGGTAGGGG + Intergenic
1179321586 21:40296952-40296974 CTCACTTTATCTCCTGGTAGAGG - Intronic
1179383842 21:40923868-40923890 GTAAATATGTTTCCTGTTAGGGG + Intergenic
950409418 3:12825597-12825619 GGATCTTTGTCTCCTGGTAGAGG - Exonic
950547086 3:13644824-13644846 GAAACTTTCATTCCTGGTGGTGG - Intergenic
950701563 3:14753572-14753594 GTAAATTTTTTTCCTGTGAGTGG + Intronic
951209266 3:19956574-19956596 GTAACTTTTATTCCTGTTACAGG - Intronic
951989496 3:28660892-28660914 GTCACTTTGTTTCTGGGTGGTGG + Intergenic
952264343 3:31770877-31770899 GTTAATTTGTTTACTGGTCGAGG + Intronic
952528211 3:34235773-34235795 GTAACTATTTTTCCTAGTTGTGG + Intergenic
954458692 3:50613596-50613618 GTAACTCTGTTGCCTGGCAGCGG - Intronic
955828980 3:62981289-62981311 TTATCCTTATTTCCTGGTAGGGG - Intergenic
956621989 3:71230454-71230476 GTTCCTTTGTTTCCAGGTAGAGG - Intronic
962688238 3:137868053-137868075 GTAAATTGGTGTCCTTGTAGCGG - Intergenic
962722506 3:138188451-138188473 GTAACTTTCATTCCTGGTCCTGG - Exonic
963607492 3:147423647-147423669 GTATCTTTTTTTCATGATAGTGG - Intronic
964948847 3:162262062-162262084 TTAACCTTTTTTGCTGGTAGAGG - Intergenic
964976296 3:162623962-162623984 TTAACTTGGTTTCCTTGCAGTGG + Intergenic
966625871 3:182016440-182016462 GTATCTTTGTTTCATGATACTGG + Intergenic
966749787 3:183310872-183310894 GTAACTTTCTTTTCTGGTACCGG - Intronic
970810808 4:20092005-20092027 GTAATGTAGTTTCCTGGCAGAGG + Intergenic
971289911 4:25328049-25328071 GTAATTTTTTTTCCTGGTTTTGG + Intronic
972850099 4:43038277-43038299 ATTAATTTGTTTACTGGTAGTGG + Intergenic
975701849 4:77075183-77075205 GTAACTTTTTTTTGTGGCAGCGG - Intronic
976797464 4:88950623-88950645 GTCACTCTTTTTTCTGGTAGTGG - Intronic
977598371 4:98909156-98909178 GTTGCTTTTTTTCCTGGTAGTGG - Intronic
978636571 4:110815268-110815290 GTAGATTTGCTTCCTGGGAGTGG + Intergenic
980488046 4:133485844-133485866 GTAACTTTGTTTCTTAATATTGG - Intergenic
980490691 4:133524270-133524292 GTAAATTTTTTTCATGGTAATGG - Intergenic
987732134 5:21787351-21787373 GTAATCTTGTTTGCTGGTAGAGG - Intronic
989588429 5:43091387-43091409 TTAACTTTGTTTTCAGTTAGGGG + Intronic
993356922 5:86925094-86925116 GTATGTTTGTTTCTTGGTGGTGG + Intergenic
993570240 5:89528095-89528117 GTAAGTTTGTTTCCTTGTAATGG - Intergenic
995601920 5:113806928-113806950 GTAACTTTGTTTTCTGCTTAGGG - Intergenic
999503949 5:152176093-152176115 GTAACTTTGCTTCCTTCCAGAGG + Intergenic
1000860406 5:166450310-166450332 GCAGCTTTGTTTACTGGGAGAGG + Intergenic
1004407193 6:15344153-15344175 GAAACTTACTTTCGTGGTAGTGG + Intronic
1004604650 6:17182546-17182568 GTAACTTTGTTTCCTTTTAGTGG + Intergenic
1005363488 6:25054621-25054643 ATACCTTCGTTTCATGGTAGAGG + Intergenic
1009162175 6:60296670-60296692 GTTACGTTGTTTCCTGGTTTTGG + Intergenic
1010528762 6:76941155-76941177 TTAACTTGGTGTCCTTGTAGTGG - Intergenic
1011919206 6:92549578-92549600 GTAACAATGTTTTCTGGGAGAGG + Intergenic
1015188783 6:130449936-130449958 GTAACTAGGTTTTGTGGTAGTGG + Intergenic
1016123035 6:140367277-140367299 TTGACTTTGGTTCCTGGAAGGGG - Intergenic
1017749379 6:157476593-157476615 GTAATTTTCTTTTCTTGTAGGGG - Intronic
1020447464 7:8284086-8284108 GGAACTTGGTCTGCTGGTAGTGG + Intergenic
1023643487 7:42284733-42284755 GTCACCTTCTTTCCTGGGAGGGG - Intergenic
1025277362 7:57595134-57595156 GTAAATTTGTATGCTAGTAGGGG + Intergenic
1027535391 7:79393641-79393663 GAAACTTTGTTTCCTTTTATTGG + Intronic
1033991182 7:147289031-147289053 GTAACTTGGTTTCCTTATAGAGG - Intronic
1037516242 8:19634761-19634783 GCCACTTTGCTTCCTGGTAAGGG - Intronic
1038254377 8:25937330-25937352 GAAACTTTGTTCCCTTGTATGGG - Intronic
1038965248 8:32564902-32564924 CTAACTTTTTTTTTTGGTAGTGG - Intronic
1040758830 8:50813138-50813160 GTCAGTGTGTTTCCAGGTAGAGG + Intergenic
1042579393 8:70260040-70260062 GTAACTTTGTTTCCTGGTAGTGG - Intronic
1045302842 8:100928807-100928829 ATAACTTTGATTCCTGATTGTGG - Intronic
1046002625 8:108439991-108440013 CTATCTTTGTTACCTGCTAGTGG + Intergenic
1047189538 8:122665630-122665652 GTGACTTTGTTACATGGTGGGGG - Intergenic
1051485830 9:17606792-17606814 GTAATTTTATTTCTTGGTTGTGG - Intronic
1052039979 9:23727216-23727238 GTCACTTTTTTTCCTGGTTAAGG - Intronic
1053298670 9:36933554-36933576 CTAACTCTGCTTCCAGGTAGGGG - Intronic
1055688595 9:78805492-78805514 GGAACTTTGGTTCCTTTTAGTGG + Intergenic
1057425053 9:94941584-94941606 CTCAGTTTGTTTCCTGTTAGAGG + Intronic
1057517662 9:95735759-95735781 GTAACTCTGCCTCCAGGTAGAGG - Intergenic
1058169621 9:101664612-101664634 GAAATTTTTTTTCCTGATAGGGG - Intronic
1058285694 9:103175509-103175531 GTACATTTGTTTGCTGGTACAGG + Intergenic
1058900854 9:109440897-109440919 TTAACTTTGTTTCCCCCTAGTGG - Intronic
1059668408 9:116471380-116471402 GTAACTTCTTTTTCTGGCAGGGG + Intronic
1060232200 9:121833881-121833903 GTAATTCTGTTTCCTGGGATTGG + Intronic
1185639082 X:1576592-1576614 GTATCTTTATTTCCTGTTTGAGG + Intergenic
1185860209 X:3571423-3571445 GTAACTTTGTTACCAGGAAGGGG - Intergenic
1186811822 X:13197743-13197765 ACAACTTTGTTTTTTGGTAGGGG + Intergenic
1187223835 X:17356402-17356424 GTCAGTTAGCTTCCTGGTAGAGG + Intergenic
1187761525 X:22591586-22591608 GTCAGTTTGGTTCCTGGTAAGGG - Intergenic
1188106618 X:26155182-26155204 GTAACCTTTTTTGCTGGTGGAGG + Intergenic
1192338857 X:70245178-70245200 GCAAGTTTGGTTCCTGGTAAGGG + Intergenic
1192726076 X:73753319-73753341 TTAACTTGGTGTCCTTGTAGGGG + Intergenic
1194372639 X:93092252-93092274 TTAACTTTGTGTCCTTGTGGTGG + Intergenic
1194471442 X:94302607-94302629 CTAAGTTTGTTTCCAGGCAGTGG + Intergenic
1195216106 X:102704573-102704595 GTAACTTTTTTACCTGGTCTTGG - Intergenic
1198216393 X:134559020-134559042 GTAACTTGTTTTCCTTGAAGAGG + Intergenic
1198362336 X:135907842-135907864 GTAAGTTTGTTTACTAGTTGTGG + Intronic
1198700445 X:139391943-139391965 GTAAGGTTGTTACCTGGAAGTGG - Intergenic
1199235392 X:145487095-145487117 TTAATTTTTTTTCCTGGAAGGGG - Intergenic
1199620433 X:149696213-149696235 GCAAATTTATTTCCTGGAAGAGG + Intronic
1200680676 Y:6206295-6206317 TTAACTTTGTGTCCTTGTGGTGG + Intergenic
1200825513 Y:7635331-7635353 GTTCCTTTGCTTCCTGTTAGGGG - Intergenic
1202043687 Y:20714445-20714467 CTGAGTTTGTTTCCAGGTAGAGG - Intergenic
1202234544 Y:22695764-22695786 GTTCCTTTGCTTCCTGTTAGGGG + Intergenic
1202308615 Y:23500404-23500426 GTTCCTTTGCTTCCTGTTAGGGG - Intergenic
1202562186 Y:26170182-26170204 GTTCCTTTGCTTCCTGTTAGGGG + Intergenic