ID: 1042579710

View in Genome Browser
Species Human (GRCh38)
Location 8:70263359-70263381
Sequence TGTGGCCCAAATTTATTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042579710_1042579713 10 Left 1042579710 8:70263359-70263381 CCATGCAATAAATTTGGGCCACA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1042579713 8:70263392-70263414 GATAACTGAAACCACGTATAAGG No data
1042579710_1042579714 11 Left 1042579710 8:70263359-70263381 CCATGCAATAAATTTGGGCCACA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1042579714 8:70263393-70263415 ATAACTGAAACCACGTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042579710 Original CRISPR TGTGGCCCAAATTTATTGCA TGG (reversed) Intronic
903049740 1:20591643-20591665 TGTGGCCCATTTGCATTGCAGGG + Intronic
906006804 1:42480094-42480116 TGTGAGATAAATTTATTGCAAGG - Intronic
909500139 1:76325443-76325465 TGCAGCCCAAGTTTTTTGCAAGG + Intronic
910084680 1:83385395-83385417 TCAGGCCCAAATTTATTCCCTGG + Intergenic
913409617 1:118536827-118536849 TTTGGCACTAATTTATGGCATGG - Intergenic
916290837 1:163164620-163164642 TCTGACACACATTTATTGCAAGG - Intronic
1063252830 10:4292834-4292856 TCTTGCCCAAATTTAAAGCAAGG + Intergenic
1065100941 10:22333161-22333183 TGTGGTCCTAATTTAGTTCAAGG - Intergenic
1069266578 10:66465892-66465914 TGTGAACAAAATTTATTGAATGG + Intronic
1069586166 10:69604096-69604118 GGTGGCCCAGAGTAATTGCAAGG + Intergenic
1071744671 10:88403502-88403524 TGTGACCCAAAATTATTTGATGG - Intronic
1076034263 10:127185877-127185899 TGGGGCCCCAATATACTGCATGG - Intronic
1078949867 11:16118080-16118102 TGTGGCCAAAATATATCGCTGGG + Intronic
1080931002 11:36810743-36810765 TCATGCACAAATTTATTGCACGG - Intergenic
1082045756 11:47724941-47724963 TGTGGGCCAAATTTTTTTCAAGG - Intronic
1087408472 11:97759637-97759659 TGTTGCCCAATTTTATTGTTTGG - Intergenic
1087607280 11:100392241-100392263 AGAGGCACAAATTTCTTGCAGGG - Intergenic
1088301872 11:108366801-108366823 TGTGTCCCACCTTTATGGCAGGG + Exonic
1091749629 12:3014307-3014329 TGTGGCCCACATTTGCTTCAGGG + Intronic
1092744318 12:11659389-11659411 AGTAGCCCACACTTATTGCATGG - Intronic
1093187582 12:16038804-16038826 TGGGGGGCAAATTTATTCCAAGG + Intergenic
1095161919 12:38927986-38928008 TATGGTCCAAACTTACTGCAAGG + Intergenic
1097522591 12:60688207-60688229 TGTGGGCCAAATTTGTTTCCTGG - Intergenic
1098227240 12:68337289-68337311 TGTGCCCCAAATGTATTCCCTGG - Intergenic
1098973039 12:76876188-76876210 TTTGGCCCTAATGTATTACATGG + Intronic
1102382085 12:112475373-112475395 TGAGGCCTAGATTGATTGCAGGG + Intronic
1104478100 12:129087057-129087079 TGGGGCCCTAATGTATAGCATGG - Intronic
1106342419 13:28843176-28843198 TGTGGCACAAATTTAGTTCTAGG - Intronic
1110944047 13:81390605-81390627 TGTTTTCCTAATTTATTGCAAGG - Intergenic
1114913860 14:27236716-27236738 TGTTGCCTAAATTCTTTGCATGG + Intergenic
1117638580 14:57773872-57773894 TGTGGCACGAATTTAATACATGG - Intronic
1117710495 14:58524114-58524136 TCTGGCCTAAATTTATTTGAGGG - Intronic
1118250898 14:64159933-64159955 TGTGGCCCTAGTTAATTGCAGGG + Intronic
1120532497 14:85648996-85649018 TGTAGCCAAAATATTTTGCATGG - Exonic
1127059238 15:55165094-55165116 TGTGGACCAATATTACTGCAGGG - Intergenic
1127435114 15:58949747-58949769 AGTGTCCCAAATTTATTTTAGGG - Intronic
1130771064 15:86924361-86924383 TGAGGCTCAATTTTATTGCAAGG + Intronic
1138932220 16:61673655-61673677 TGTGCCTCAAATTTCTTCCATGG - Intronic
1139774227 16:69304462-69304484 TGTTACTCAAAATTATTGCATGG + Exonic
1140336814 16:74114841-74114863 AGTGGCCCACATTTGTTCCAAGG - Intergenic
1142544629 17:691570-691592 TGTGGTCCAAAAATATTACATGG + Intronic
1146018791 17:29256398-29256420 GGTGACCCATATTAATTGCATGG - Exonic
1149358361 17:55867954-55867976 TGGGGCATAAATTTATTCCATGG + Intergenic
1150444376 17:65217193-65217215 TGTGGCCCCAGCTAATTGCAGGG - Intronic
1152675784 17:81640400-81640422 TGTGTCCCAATTTTCTTGTAAGG + Intronic
1155870900 18:31026776-31026798 TGTGGCTCTAACTAATTGCAAGG - Intronic
1158319997 18:56251886-56251908 GGTGGCCCATATTTCTTGCCAGG - Intergenic
1164446678 19:28323636-28323658 TGTGTCCCACCTTTATCGCAAGG + Intergenic
926673345 2:15596166-15596188 TGTGGGCCAGATTTTTCGCAAGG + Intronic
929063908 2:37953075-37953097 TGTCCCCCAAATTTATTTCATGG + Intronic
930151729 2:48066857-48066879 TGTGGCCCAGAGTTCTTTCATGG + Intergenic
930382628 2:50651097-50651119 TGTGACCCAAATAAATTGTAAGG + Intronic
932733855 2:74240348-74240370 TTTGGCCTATATTTAATGCATGG + Intronic
936615146 2:114040855-114040877 TGTGGCCTGAACTGATTGCATGG - Intergenic
940162007 2:150723628-150723650 CCTGGCCCAATTCTATTGCATGG + Intergenic
943615561 2:190087954-190087976 TGTGTCCGGAATTTTTTGCATGG - Intronic
945665470 2:212735988-212736010 TGTGGCCCAAAAATATTAAATGG - Intergenic
948995680 2:241577043-241577065 TCTGGGCCAAACTCATTGCAGGG + Intergenic
1169008725 20:2231816-2231838 TGTGGCTAAGATTTATTACAGGG + Intergenic
1169481087 20:5981407-5981429 TGTGTCCCATATTCATGGCAGGG - Intronic
1169755500 20:9039163-9039185 TCTTCCCCAAATTTATTGCTTGG + Intergenic
1169970254 20:11262000-11262022 TGTGTCTCAACTTTATTGTAGGG + Intergenic
1173160880 20:40651960-40651982 TGAGGACCAAATTTAATGGATGG - Intergenic
1175502791 20:59462116-59462138 TGTGGCCCAAGCTTCTAGCATGG - Intergenic
1177015226 21:15779173-15779195 TGTGGCTAATATTTATTGCCAGG + Intronic
1177110492 21:17021737-17021759 TGTGTCCCAAGTTTAAAGCAAGG + Intergenic
1177864837 21:26500323-26500345 TGTGGCCCACATCTGATGCATGG - Intronic
1178117229 21:29429834-29429856 GATGGCCCAAATTTATTGGAAGG - Intronic
1182884198 22:33759344-33759366 TGAGGCCCCAATCTATAGCATGG + Intronic
1184127572 22:42499169-42499191 TGTGGCGCAACTTCATTGTAGGG - Intergenic
951621083 3:24602877-24602899 TGTTCCCCAAACTCATTGCAGGG - Intergenic
952552570 3:34495929-34495951 TTGGGCCCAAATTTATTCTAGGG + Intergenic
953086419 3:39672449-39672471 TATCGCCCAAATTCACTGCAAGG + Intergenic
954181510 3:48884695-48884717 TGTGTGGAAAATTTATTGCAAGG + Intronic
956068793 3:65425460-65425482 TCTGGCTCAAATTTTATGCAAGG - Intronic
956306032 3:67826753-67826775 TCTGGCCCCAATCTAATGCAAGG + Intergenic
956787472 3:72654510-72654532 TGTGGGTCAGAGTTATTGCAGGG - Intergenic
961512779 3:127413256-127413278 AGGGGCCCAAGGTTATTGCATGG - Intergenic
962072016 3:132043647-132043669 TGTCTTCTAAATTTATTGCAAGG - Intronic
962318247 3:134371989-134372011 TGGGGCCCCAATTTATTGGCAGG + Intronic
965734496 3:171806478-171806500 TGTGGCTAAAAGTTGTTGCAGGG - Intronic
966628395 3:182044916-182044938 TTTGGTCAACATTTATTGCATGG + Intergenic
966640736 3:182186989-182187011 TGTGGCCCGATTTTCTTGCCTGG + Intergenic
967957126 3:194885923-194885945 TGTGGCACAAATGTCTTGCCTGG + Intergenic
971156780 4:24091691-24091713 TGTGTCCCAAATTTGTTCCCCGG - Intergenic
972737925 4:41863900-41863922 TGTGGCCCAAATGCATTGGGAGG - Intergenic
972838410 4:42903276-42903298 TGTGGCCCAAATTTTTTATTTGG - Intronic
976987571 4:91321349-91321371 AGCGGCCAAAATTTATTCCATGG + Intronic
977287610 4:95128268-95128290 GGTGGCCCAATGTAATTGCATGG + Intronic
978745612 4:112190658-112190680 TGTTGCCCAGATTGAGTGCAAGG - Exonic
979947380 4:126850171-126850193 TGTGGCCTAAAATTGTGGCATGG - Intergenic
980389837 4:132128960-132128982 TATAGCCCAAATTTAGAGCAAGG - Intergenic
984094037 4:175412022-175412044 TGTGGTCCAAATATATTAGATGG - Intergenic
984180029 4:176470821-176470843 TGTGGGCCAACTTTATAGCACGG + Intergenic
984499557 4:180542059-180542081 TGAGGCCCAAAGTTATTCCCAGG + Intergenic
994256254 5:97600073-97600095 TGTGGCATAAATTTCTTCCAGGG + Intergenic
996883719 5:128330861-128330883 TTTGGCCCACATTTATAGCCTGG - Intronic
999194176 5:149770939-149770961 TGTGACACAAAATTATTACAGGG + Intronic
1000337853 5:160254708-160254730 TGTGCCCCATAGTTACTGCAGGG - Intronic
1000639626 5:163686199-163686221 TGTGGCCCACATTTGGTCCATGG - Intergenic
1000826125 5:166046222-166046244 GGTGCCAGAAATTTATTGCATGG - Intergenic
1002060863 5:176625190-176625212 TGTGGCCACAATCTCTTGCAGGG + Intronic
1005109974 6:22270462-22270484 TTTGGCCCAATTTGGTTGCAAGG + Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1006918379 6:37611023-37611045 TGTGGCCCAACTGAACTGCAAGG + Intergenic
1009053183 6:58303404-58303426 TGAGGACTAAATTTAGTGCATGG - Intergenic
1016072925 6:139762060-139762082 TTAGGCCCAAATTTTTGGCAAGG - Intergenic
1016768396 6:147820661-147820683 TGTCGCCCAACTTGATTACATGG - Intergenic
1017202811 6:151774143-151774165 TATAGTCCAAATTTATTGCAAGG - Intronic
1019084408 6:169461577-169461599 TGTGTCACAGATTTTTTGCATGG - Intronic
1020347916 7:7184484-7184506 TGTATCACAAATTTATTTCAGGG + Intronic
1020356465 7:7280917-7280939 TGGGGGAGAAATTTATTGCAGGG - Intergenic
1023003963 7:35842477-35842499 TGTGGATCAAATTTTTAGCAGGG + Intronic
1025219767 7:57097229-57097251 TGTGGGTCAAATTTTTAGCAGGG - Intergenic
1025630550 7:63268776-63268798 TGTGGGTCAAATTTTTAGCAGGG - Intergenic
1030835689 7:114281796-114281818 TGTGGCTCCAATTTTTTTCAAGG + Intronic
1031756301 7:125647461-125647483 TGTGGTCTAAATTTTGTGCAGGG - Intergenic
1032186257 7:129729281-129729303 TGTGGTTCAACTTTATTGTATGG - Intronic
1032993672 7:137421941-137421963 TGTCTCCAAAATTGATTGCAAGG - Intronic
1033124121 7:138692448-138692470 TGTGTCACATATTTTTTGCATGG - Intronic
1037274323 8:17161226-17161248 TGTAGCTCAAATTCATTTCATGG - Intronic
1038930503 8:32188569-32188591 TGTGGACCCAATGTATTCCAAGG + Intronic
1040908285 8:52491487-52491509 GGTGGCCCAAATGAATTGAAGGG + Intergenic
1042578121 8:70244836-70244858 TGTGACCCAAATTGATTCCGTGG - Intronic
1042579710 8:70263359-70263381 TGTGGCCCAAATTTATTGCATGG - Intronic
1047242606 8:123106175-123106197 TGTGGTCCAAATATATTCAAAGG + Intronic
1053531439 9:38886157-38886179 TGTTGCTGAAATTGATTGCAGGG + Intergenic
1054884113 9:70177460-70177482 TGTGGCCCAAAAATATTACATGG - Intronic
1059882898 9:118711437-118711459 TGTGGCACATCTTTATTGCTTGG + Intergenic
1062304659 9:135897828-135897850 TGTGGCCTGAATATATTACATGG - Intronic
1188906722 X:35799773-35799795 TGTGGCCCAGATCTTTTTCATGG - Intronic
1197447552 X:126569116-126569138 TGTGGCCCAAAAATATTAAATGG - Intergenic