ID: 1042581407

View in Genome Browser
Species Human (GRCh38)
Location 8:70283034-70283056
Sequence AATTCAGTACAGACAGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042581406_1042581407 6 Left 1042581406 8:70283005-70283027 CCACAAGCAGGGCTAAACACTGA 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG No data
1042581405_1042581407 7 Left 1042581405 8:70283004-70283026 CCCACAAGCAGGGCTAAACACTG 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG No data
1042581404_1042581407 10 Left 1042581404 8:70283001-70283023 CCACCCACAAGCAGGGCTAAACA 0: 1
1: 0
2: 2
3: 9
4: 119
Right 1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG No data
1042581401_1042581407 18 Left 1042581401 8:70282993-70283015 CCAGAAGGCCACCCACAAGCAGG 0: 1
1: 0
2: 1
3: 20
4: 215
Right 1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042581407 Original CRISPR AATTCAGTACAGACAGAGCT TGG Intronic
No off target data available for this crispr