ID: 1042587652

View in Genome Browser
Species Human (GRCh38)
Location 8:70359553-70359575
Sequence CTCTTGAAGGGGAAGTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042587645_1042587652 29 Left 1042587645 8:70359501-70359523 CCAGAATAGGTAAATTCATAGAG 0: 12
1: 137
2: 566
3: 1485
4: 2323
Right 1042587652 8:70359553-70359575 CTCTTGAAGGGGAAGTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042587652 Original CRISPR CTCTTGAAGGGGAAGTTACA AGG Intronic
No off target data available for this crispr