ID: 1042588665

View in Genome Browser
Species Human (GRCh38)
Location 8:70372458-70372480
Sequence GAGTAGGATTTTGGGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042588665 Original CRISPR GAGTAGGATTTTGGGTTGGT GGG (reversed) Intronic
904496855 1:30892019-30892041 GAGGAGGATGTTGGGTTGGGGGG - Intronic
905318267 1:37097289-37097311 GAGGTGGAGTTTGGGTTGGAAGG + Intergenic
905382375 1:37572121-37572143 GAGGAGTACTTTGGGGTGGTCGG - Intronic
905968896 1:42125214-42125236 GAGTAGTATTGTGGGGTTGTAGG - Intergenic
906529465 1:46515176-46515198 GAGGAGGTTTTTGGTTTGGGAGG + Intergenic
910219019 1:84871606-84871628 GAGTTGGATGTTAGGTTAGTTGG + Intronic
911313880 1:96332037-96332059 GAATATGATTATGGGTTTGTTGG + Intergenic
913071740 1:115304944-115304966 GAGTTTGAGTTTGGGTTTGTGGG + Intronic
915741159 1:158119273-158119295 GAGGAGCATTTTGGGTTAGGGGG + Intergenic
916337388 1:163688600-163688622 GAATAGGATTATTGGTTGCTTGG + Intergenic
919673934 1:200362732-200362754 GTTTAGAATTTTGGGTTGTTGGG + Intergenic
920079691 1:203363638-203363660 GAGTAGCATTGTTGGTTCGTTGG + Intergenic
920187974 1:204173813-204173835 GAGTATAATTTTGGGTGGGAGGG - Intergenic
922017492 1:221665639-221665661 GAGTTGGAATTTGGGGTGGGTGG - Intergenic
1063068415 10:2634274-2634296 AAGGAGGATTTTTGGTTGGGTGG - Intergenic
1063349782 10:5343476-5343498 GAGAAGGATTTTAGGGGGGTTGG + Intergenic
1064186232 10:13164043-13164065 TGGTAGGATTCTGGGTTTGTTGG + Intronic
1065040872 10:21694795-21694817 CAGTAGAAGTTTGGGTTGGCTGG + Intronic
1065295656 10:24272020-24272042 GAGTAGGAAATTGGGTGGGAAGG + Intronic
1071827430 10:89339154-89339176 GAGGAGAATTCTGGGTTGTTGGG - Exonic
1074483401 10:113849646-113849668 TAATTGTATTTTGGGTTGGTTGG + Exonic
1074876219 10:117615503-117615525 GGGCAGGATTTTGGCTTTGTTGG + Intergenic
1075871933 10:125777512-125777534 GCCTAAGATTTGGGGTTGGTGGG + Intergenic
1077515325 11:2998379-2998401 CAGTAGGAGGTGGGGTTGGTGGG - Intergenic
1081047958 11:38299129-38299151 GAGTAAGAGTTTCGGTTGTTGGG + Intergenic
1081677147 11:44976878-44976900 GAGCAGGAATTTTGGTTGCTAGG - Intergenic
1083135558 11:60672340-60672362 AAGTAGGATTCTTGGTTGATAGG + Intergenic
1083990870 11:66244977-66244999 GAGGTGGATTTGGGGATGGTGGG - Intergenic
1084070467 11:66730185-66730207 AGGTAGGATTATGTGTTGGTTGG + Intergenic
1084879687 11:72161901-72161923 GAGTGGAATTTTGGGTTGTATGG - Intergenic
1089721584 11:120428804-120428826 AGCTAGGATTTTTGGTTGGTTGG + Intronic
1090497089 11:127223774-127223796 GAGTAGGTTTGTAGGTTTGTGGG + Intergenic
1092420901 12:8330937-8330959 GAGTATGATTTTTGATTGGGAGG + Intergenic
1092483485 12:8881577-8881599 AAGTAGGATTTTGTGCTGGAAGG - Intronic
1096672318 12:53207297-53207319 GGGGAAGATTTGGGGTTGGTGGG + Exonic
1096740309 12:53688704-53688726 GAGTAGAATTTGGGGTTGGGTGG - Intergenic
1096805186 12:54136312-54136334 GTGTAGGATTTTGGGTGTGATGG - Intergenic
1100143474 12:91648178-91648200 GAGCTGGATATTGGCTTGGTGGG + Intergenic
1104770479 12:131359185-131359207 GAGTTGGTTTTTTGTTTGGTTGG - Intergenic
1106911588 13:34468862-34468884 GAGCAGGAGTTTTGGATGGTGGG - Intergenic
1107217538 13:37939127-37939149 GAGTAGGGATTTCGCTTGGTTGG + Intergenic
1107816522 13:44249681-44249703 GAGCAGGAGTTTGGGGTGGGAGG - Intergenic
1109787395 13:67196760-67196782 AGGTAGGATTTTGGGTTTTTTGG - Intronic
1110541882 13:76715216-76715238 GAGTTGCAATTTGAGTTGGTAGG - Intergenic
1110602868 13:77395889-77395911 GAGTAGGGTTTGTGGGTGGTAGG + Intergenic
1114259867 14:21028713-21028735 GAGATGGATTATGGGTGGGTGGG + Intronic
1115409115 14:33052343-33052365 GAGTAGTTTTTGGGGGTGGTAGG - Intronic
1118857326 14:69633921-69633943 CAGTAGGATTTTGGGTGGCCTGG + Intronic
1119459973 14:74793300-74793322 TAGTAGGATTTTGGATCTGTTGG + Intronic
1120040750 14:79750166-79750188 GATTAGTACTTAGGGTTGGTTGG + Intronic
1123662453 15:22576112-22576134 CAGTAGGAGTTAGGGTTGGAGGG + Intergenic
1123787775 15:23689900-23689922 GAGTAGAAGTTTGGGTAGGTGGG + Intergenic
1124316253 15:28670396-28670418 CAGTAGGAGTTAGGGTTGGAGGG + Intergenic
1128128548 15:65210632-65210654 GAGTCAGATTCTGGGTTGGCCGG - Intronic
1131036981 15:89229220-89229242 AAGTAGGAGTTTGGGTGGTTTGG + Intergenic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131640211 15:94284117-94284139 GAGTAGAATTATTGGTTTGTAGG - Intronic
1137289868 16:47044925-47044947 GAGTACAATTTTTGGTTCGTAGG - Intergenic
1138718662 16:59053237-59053259 GAGTTGGCTTGTGAGTTGGTGGG + Intergenic
1140150847 16:72363484-72363506 GAGTAGGAGTTTGGGTGTGGAGG - Intergenic
1141783066 16:86177312-86177334 GACTAGGATTTTGGGGTGTGAGG + Intergenic
1142823233 17:2489041-2489063 CAGTAGGATTTTGGATTCTTTGG - Intronic
1143532604 17:7513913-7513935 GGGGAGTATTTTGGGGTGGTGGG - Exonic
1144409596 17:14987802-14987824 GTGTAAGATTGTGGTTTGGTAGG + Intergenic
1146585940 17:34081572-34081594 GAGAAGGATTTTGAGGTGGTGGG - Intronic
1149526568 17:57360427-57360449 GAGTAGGGTTTTGGCTTTGTTGG + Intronic
1155142064 18:23052654-23052676 GATTAGGAGTTGGGGGTGGTGGG - Intergenic
1155454775 18:25999307-25999329 GAGTAGAATTTTGGATTTTTTGG - Intergenic
1159096541 18:63908530-63908552 GAGTGGGGTTTTGGGTTTGTGGG - Intronic
1165838778 19:38774534-38774556 GAGGTGGGTTTTGGGGTGGTGGG + Intergenic
1168627397 19:57930282-57930304 GGGTAGGTTTTGTGGTTGGTAGG - Intronic
925705316 2:6679333-6679355 GAGTAGGGTTTTGGGGTCTTAGG + Intergenic
925962772 2:9033947-9033969 GAGTAGGAGTTGTGGATGGTTGG - Intergenic
928489159 2:31763531-31763553 GAATGGGAGATTGGGTTGGTGGG + Intergenic
928720315 2:34113667-34113689 GAGTGGGATTTTGTCTTGGGAGG + Intergenic
929623518 2:43381970-43381992 GACTAGGATTATGGGTTTTTGGG - Intronic
931494620 2:62789452-62789474 GAGTAGGCCTTTTGGTGGGTGGG - Intronic
935320329 2:101881380-101881402 CAGCAGGGTTTTTGGTTGGTTGG + Intronic
936670564 2:114651477-114651499 GAGATGGATTTAGGCTTGGTGGG - Intronic
938188768 2:129255761-129255783 GAGTAGGTGTTTAGGTGGGTGGG - Intergenic
940541079 2:155019049-155019071 GTGTAGAATTTTGGGTTGATAGG + Intergenic
941950838 2:171154921-171154943 GAGTTGGATTTTTAGGTGGTGGG - Intronic
942082973 2:172418711-172418733 GAGCAGGACTTTGGGGCGGTTGG - Intergenic
1171007915 20:21485709-21485731 GAGCAGGATTTTGGCTTGAGAGG + Intergenic
1173384219 20:42573327-42573349 GAGTTGGAGGTTGGGTGGGTGGG - Intronic
1174947977 20:55009886-55009908 TAATAGAATTTTGGGTTGGTGGG + Intergenic
1175537992 20:59728862-59728884 GCGGAGAATTTTGGGTTGGGTGG + Intronic
1175591297 20:60194048-60194070 GTGTATGGTCTTGGGTTGGTGGG - Intergenic
1178614569 21:34120197-34120219 GAGTAGTATTTAGTCTTGGTAGG + Intronic
949521855 3:4863689-4863711 AAGTAGGCTTTTGGCTTAGTGGG - Intronic
950599230 3:14017256-14017278 GACTAGTCTTTTGGGTTGGGCGG - Intronic
952232831 3:31448839-31448861 GAGTAGGCTCTTGGGTTCCTGGG - Intergenic
954123680 3:48516331-48516353 GAGTAGCATTTTGGGTTACTGGG - Intergenic
954665099 3:52247337-52247359 GAGGATGAGATTGGGTTGGTTGG + Intronic
954872520 3:53778446-53778468 GACTAGGAATTTGGGTGGGATGG + Intronic
955969725 3:64426251-64426273 GGCTAGGAGTTTGGGTTGGAAGG - Intronic
962116310 3:132512488-132512510 GATTAGGATTTGAGGTGGGTAGG + Intronic
964403831 3:156328020-156328042 GGCTAGAATTTTGGGGTGGTGGG - Intronic
964836784 3:160947946-160947968 GATTAGAATTTTGGGTGGTTAGG - Intronic
966240565 3:177751496-177751518 GTGAAGGGTTTTGGGTTGGGAGG + Intergenic
966567006 3:181394950-181394972 GTATAGTATTTTGGGTTGATGGG + Intergenic
967207401 3:187136636-187136658 GAGTAGTTTTTTGGGTGGGGTGG + Intronic
968263169 3:197341104-197341126 GAGATGGGTTTTGGTTTGGTTGG + Intergenic
968275839 3:197439674-197439696 GATTAGGATTAGGGGTTGTTAGG + Intergenic
975733570 4:77360270-77360292 GAGAAGGGGTTTGGGTTGCTAGG - Intronic
978830001 4:113072400-113072422 CAGTTGGAATTTGGGGTGGTGGG + Intronic
979164010 4:117503009-117503031 TAGTATGATTATGGGTTGGCTGG - Intergenic
980501766 4:133664827-133664849 GAATGGGATTTTGGGTTTGGGGG - Intergenic
982622034 4:157720504-157720526 GAGTAGGATGAAGGGTTGATGGG - Intergenic
985982984 5:3487978-3488000 GAGGCTGATTTTGGGTTGGATGG - Intergenic
988224227 5:28391334-28391356 GTGTAGAGTGTTGGGTTGGTAGG + Intergenic
988832937 5:35004839-35004861 GAGTTGGATCTGGGGTTGGTGGG - Intronic
989342320 5:40389713-40389735 GAGTAGGCTTTTGGGTAAGCAGG + Intergenic
992087748 5:73293357-73293379 GGGTAAGATTTTGAGTTGTTTGG + Intergenic
992995567 5:82329195-82329217 GAGTGGGAATTTGGATTTGTGGG - Intronic
994006262 5:94840906-94840928 GAGGTGGATTTTGGGGTGGGGGG + Intronic
995304843 5:110632902-110632924 GAAAAGTATTTTGGGTTTGTGGG - Intronic
996563512 5:124856064-124856086 GAGTAGTACTTTGGGATGGCTGG - Intergenic
998055980 5:139077763-139077785 TAGTAGGATTTTGGGTGTGTTGG - Intronic
1003759303 6:9157806-9157828 GTGTAGAATTTTGTTTTGGTAGG + Intergenic
1008131242 6:47721673-47721695 GAGTGGGAGTGTGGGTTGGCAGG + Exonic
1008350973 6:50489943-50489965 GAGTAGGATATTTTGCTGGTAGG + Intergenic
1011525506 6:88260105-88260127 GTGTAAGGTTTGGGGTTGGTGGG - Intergenic
1015837633 6:137438730-137438752 GGGTAGAAACTTGGGTTGGTTGG - Intergenic
1019370555 7:660690-660712 GAGTAGGTATTTGGATTTGTTGG - Intronic
1020920253 7:14254521-14254543 GAGTAAGATTCAGGGTTGCTGGG - Intronic
1021546945 7:21824157-21824179 GAGGAGTATTTTGGGTTTTTAGG + Intronic
1022195676 7:28065179-28065201 GAGTAAGATTTGGGGGTGGTAGG + Intronic
1022392284 7:29953809-29953831 GGGTTGGATTTTGGTTTTGTAGG - Intronic
1024433917 7:49325808-49325830 GTGTAGGATTTTCCGTTGGCAGG - Intergenic
1024850693 7:53713090-53713112 GTATAGAATTTTGGGTTGATGGG - Intergenic
1026475018 7:70727783-70727805 GAGTAGGATTTTAACTTGTTAGG - Intronic
1026865252 7:73820079-73820101 GATTAGGATTATGGGTTTTTAGG + Intronic
1026879435 7:73899524-73899546 GTGTATGATTTTGGATTGTTGGG + Intergenic
1027199389 7:76053571-76053593 GATTCGGATTTTGGTTTGTTGGG + Intronic
1028797803 7:94924828-94924850 GAGTAAGAATTTCGTTTGGTAGG - Intronic
1029432847 7:100542770-100542792 GATTAGGGTTTGGTGTTGGTGGG + Intronic
1030528397 7:110681078-110681100 GAGAATGGGTTTGGGTTGGTAGG + Intronic
1030938855 7:115619780-115619802 GATTATGATTTTAGGTTGTTTGG - Intergenic
1031913147 7:127538639-127538661 GATTTGGATTTTGGGTCAGTTGG - Intergenic
1031978188 7:128106921-128106943 GAGGAGGAGTTTGGGGTGGGGGG + Intergenic
1034695287 7:153048039-153048061 GAGCACGATTCTGGGTGGGTAGG - Intergenic
1035691074 8:1560314-1560336 GAATAGTATTTTGGGTAGCTGGG + Intronic
1037182164 8:16020372-16020394 TGGTGGGTTTTTGGGTTGGTTGG - Intergenic
1038604706 8:28988450-28988472 GAGTGGGATTGTGGGGTTGTTGG + Intronic
1039362281 8:36889985-36890007 AAATAGGATTTTAGGTTGATGGG - Intronic
1040906733 8:52476839-52476861 GAGTAGAATTTTGGATTTGGGGG - Intergenic
1041977118 8:63812652-63812674 TTGTAGGTTTTTAGGTTGGTTGG + Intergenic
1042588665 8:70372458-70372480 GAGTAGGATTTTGGGTTGGTGGG - Intronic
1047855064 8:128900770-128900792 GAAAAGCATTTTGGGTTGGGTGG - Intergenic
1049317201 8:141975579-141975601 GAGGAGGGGTTTGGGTGGGTGGG + Intergenic
1054760130 9:68997439-68997461 GAGCAGCATCTTTGGTTGGTAGG - Intronic
1057483133 9:95461424-95461446 GAGCAGAATTTGGGGTAGGTGGG - Intronic
1058262035 9:102846406-102846428 GAATAGGATTTTGGGTAATTTGG - Intergenic
1059256140 9:112932993-112933015 GAGTAGGATTTGGTGCTGCTCGG + Intergenic
1187335116 X:18375025-18375047 GAGTAGGAATGGGAGTTGGTGGG + Intergenic
1188050536 X:25479702-25479724 GGCTATGAGTTTGGGTTGGTTGG + Intergenic
1189507475 X:41626299-41626321 GACTAGGATGTTGGATTGGATGG + Intronic
1192552456 X:72065105-72065127 GAGAAGACTCTTGGGTTGGTGGG + Intergenic
1194310947 X:92305613-92305635 AAGTATGAATTTGGGTTGGGGGG + Intronic
1194669271 X:96710145-96710167 TAGTAGGATTTTTGTTTGGGAGG + Intronic
1197315235 X:124957684-124957706 GAATAGCATTTTTGTTTGGTTGG - Intronic
1198113395 X:133522465-133522487 GTGTAGGATTTGGGGTTGCCAGG - Intergenic
1199296245 X:146162102-146162124 CAGGAGGATTTTGGGTTTGTCGG + Intergenic
1199387570 X:147240857-147240879 GAGCCGGATTGTTGGTTGGTTGG - Intergenic
1200619222 Y:5419888-5419910 AAGTATGAATTTGGGTTGGGGGG + Intronic
1202064827 Y:20927906-20927928 GAGTTGGATGGTGGGTTGGAGGG - Intergenic