ID: 1042589230

View in Genome Browser
Species Human (GRCh38)
Location 8:70380083-70380105
Sequence ACAGGAAACAAGTGTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042589229_1042589230 -8 Left 1042589229 8:70380068-70380090 CCTTCTATAAATAAGACAGGAAA 0: 1
1: 0
2: 1
3: 26
4: 510
Right 1042589230 8:70380083-70380105 ACAGGAAACAAGTGTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042589230 Original CRISPR ACAGGAAACAAGTGTCAAGC AGG Intronic
No off target data available for this crispr