ID: 1042590261

View in Genome Browser
Species Human (GRCh38)
Location 8:70391322-70391344
Sequence TTTTAGGCTCAGATTAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042590261_1042590265 -4 Left 1042590261 8:70391322-70391344 CCCTCCTTAATCTGAGCCTAAAA 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1042590265 8:70391341-70391363 AAAACAGAAATCTACTTCCCAGG No data
1042590261_1042590267 0 Left 1042590261 8:70391322-70391344 CCCTCCTTAATCTGAGCCTAAAA 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1042590267 8:70391345-70391367 CAGAAATCTACTTCCCAGGAGGG No data
1042590261_1042590266 -1 Left 1042590261 8:70391322-70391344 CCCTCCTTAATCTGAGCCTAAAA 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1042590266 8:70391344-70391366 ACAGAAATCTACTTCCCAGGAGG No data
1042590261_1042590270 26 Left 1042590261 8:70391322-70391344 CCCTCCTTAATCTGAGCCTAAAA 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1042590270 8:70391371-70391393 AAATATCTCAAGTTGTTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042590261 Original CRISPR TTTTAGGCTCAGATTAAGGA GGG (reversed) Intronic
901179195 1:7329087-7329109 TTTTAAGGGCAGATTTAGGAAGG - Intronic
907036683 1:51222320-51222342 TTTTAGGAACAGTTTAGGGAGGG - Intergenic
907651207 1:56296424-56296446 ATTGAGGCTCAGATTGAGGAAGG - Intergenic
911350720 1:96751203-96751225 TTTTGGGCTTAGAGTAAAGAAGG + Intronic
911666525 1:100559003-100559025 TTTTTTCCTCAGAATAAGGATGG - Intergenic
913041829 1:115034401-115034423 TTTTGGGCTCAGTTGAAGGTTGG + Intergenic
915806781 1:158861968-158861990 TTTTAGGCTCATTTTAGGGTAGG + Intergenic
916510148 1:165466207-165466229 TTCTAGGGTCAGATTAAGAGAGG - Intergenic
917442886 1:175082528-175082550 TTTTAGACTCCCATTAAAGATGG - Intronic
917557265 1:176102741-176102763 TCTTAGGAACAGTTTAAGGAGGG - Intronic
922878091 1:228956925-228956947 TTTTAGGAATAGTTTAAGGAGGG - Intergenic
1067670656 10:48317974-48317996 TTACAGGCACAGATTAAGGCAGG + Intronic
1070102223 10:73399150-73399172 TGGTAGGATCAGAATAAGGAAGG + Intronic
1070887579 10:79918421-79918443 TATTTGGCTCACATTAATGATGG + Intergenic
1072830537 10:98652970-98652992 TTTTAAGCCTAGATCAAGGATGG + Intronic
1074001415 10:109377374-109377396 TTTTATACTCAGATTAAAGAAGG + Intergenic
1074302300 10:112243370-112243392 TTTTAATATCATATTAAGGAAGG - Intergenic
1074738911 10:116465176-116465198 TTATAGGCTCAGAATGAGGGAGG + Intronic
1074883233 10:117674611-117674633 TTCAAGGCTCAGATTGATGAGGG + Intergenic
1079061628 11:17253627-17253649 TTTTAGGAGCAGTTTAGGGAGGG + Intronic
1081316702 11:41638845-41638867 TTTTAGGATCAGTTTAGGGAGGG - Intergenic
1087238104 11:95743053-95743075 TTTTAGGCACAGAGAAAGCATGG - Intergenic
1087748239 11:101974460-101974482 TTTTCAGCTCAGCATAAGGAAGG + Intronic
1088460495 11:110077323-110077345 TGTGATGCTCAGATAAAGGAAGG - Intergenic
1089583161 11:119494199-119494221 TTTAAGATTCATATTAAGGAAGG - Intergenic
1091035559 11:132229877-132229899 TTTTAGGCATAGAATAATGAGGG - Intronic
1093182130 12:15978765-15978787 TATCAGGCTCAGATTACAGAGGG - Intronic
1093261970 12:16950103-16950125 TCTTGGGCTCAGATTAATGAGGG + Intergenic
1094594578 12:31853361-31853383 TTTCAGGCTCAGATCCAGAATGG - Intergenic
1094801577 12:34043235-34043257 TTTTTGGCTGATATCAAGGAAGG + Intergenic
1096395552 12:51263436-51263458 TTTTAGTCTCATTTTACGGAAGG - Intronic
1096881740 12:54678608-54678630 TTTCAGGCACTGATTATGGAGGG + Intergenic
1098268481 12:68746913-68746935 TTTTAGGCTTATTTTAGGGAGGG + Intronic
1099248847 12:80227302-80227324 TTTTATTCTCAGGTCAAGGATGG + Intronic
1100247662 12:92778987-92779009 TTTTAGTTTTTGATTAAGGAAGG - Intronic
1102765316 12:115427888-115427910 CTTTAGGCCCAGATCAAGGAGGG + Intergenic
1102976828 12:117212784-117212806 TGTTAGGCTCAGATCAAGGGTGG - Exonic
1104641516 12:130470214-130470236 TTGTAGGATCAGAGAAAGGAGGG - Intronic
1108154835 13:47574762-47574784 TTATATGCTCAGATTAAAAACGG - Intergenic
1108473066 13:50787122-50787144 TTTTATCCTCATAATAAGGAAGG - Intronic
1108753528 13:53473312-53473334 TTTAAAGCTTATATTAAGGAAGG + Intergenic
1111300482 13:86342720-86342742 TTTTAACATCATATTAAGGAAGG - Intergenic
1117514140 14:56483685-56483707 TTAAAGCCTCAGATTCAGGATGG + Intergenic
1118266559 14:64300389-64300411 TTTTAGACTGAGATGAGGGAGGG - Intronic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1119448422 14:74686628-74686650 TTCTAGGCTCAGATCTGGGAGGG + Intronic
1122664189 14:103317345-103317367 TCTCAGGATCAGATTGAGGAGGG - Intergenic
1124039873 15:26091486-26091508 TTTTAGGAGCAGTTTAGGGAGGG + Intergenic
1125099756 15:35898657-35898679 TTTTATACTCAGATAATGGAGGG - Intergenic
1126707084 15:51415728-51415750 TTATAGGCTCAGAGGAAGAAGGG - Intergenic
1129290080 15:74559015-74559037 TTTTAGGCCCAGTTTATGGCGGG + Intronic
1132474923 16:130016-130038 TTTTAGGCACAGATGAAAGGTGG - Intronic
1133849701 16:9490911-9490933 TTTTAGTCTTACATAAAGGAAGG - Intergenic
1134767230 16:16770890-16770912 TTTTGGGCTGAGATGATGGATGG + Intergenic
1134812281 16:17177987-17178009 TTTTTGATTCAGATTGAGGAAGG + Intronic
1136598672 16:31269267-31269289 TTTTAGGAGCAGTTTAGGGAGGG + Intronic
1142633330 17:1240494-1240516 TCTTAGGAGCAGTTTAAGGAGGG - Intergenic
1143989105 17:10941702-10941724 TTTTATGCTCAGAAAGAGGAGGG - Intergenic
1144423160 17:15116252-15116274 TTATGGGCTCAGAATAGGGAGGG - Intergenic
1146931364 17:36780476-36780498 TTTTGTGGTCAGATTTAGGAGGG - Intergenic
1147839802 17:43363318-43363340 GTTTAGGCTCAGGTTAAGTGCGG - Intergenic
1148221807 17:45868244-45868266 TCTTAGGAGCAGTTTAAGGAGGG - Intergenic
1150250727 17:63703070-63703092 TTTTAAGCACAGACTAAGGCTGG - Exonic
1150299327 17:64035490-64035512 TTTTAGACTCAAATTTGGGAGGG + Intergenic
1151866021 17:76803498-76803520 TCTTAGGAGCAGTTTAAGGAGGG - Intergenic
1156663595 18:39378730-39378752 TTTAAAGCTCAGGTTAATGAAGG - Intergenic
1159726352 18:71965284-71965306 TTTTGGGGTCAGATGTAGGATGG - Intergenic
1161680086 19:5675766-5675788 TTATAGGCTCAGAATAGGGGAGG - Intronic
1165263391 19:34639830-34639852 TTTTGGCCTCTGATTATGGAAGG - Intronic
1168514433 19:56999782-56999804 TTTTAACCTCAGAGTAATGAAGG + Intergenic
927910527 2:26894986-26895008 TTTTAGGTTTAAATTAAGGCTGG + Intronic
928349006 2:30529853-30529875 TTTCAGGCTCAGATTAGGTCTGG - Intronic
928989403 2:37216972-37216994 TTTTAGACTCACCTGAAGGATGG + Exonic
931635094 2:64333539-64333561 GTTTAGGTTAAGATAAAGGATGG + Intergenic
932959156 2:76391708-76391730 TTTAATGCTCAGAATAAGGGAGG - Intergenic
933074570 2:77907177-77907199 TTATGGGCTCAGAATAGGGAAGG - Intergenic
938226502 2:129621087-129621109 TTTTAGGCTTAAATTAATGAGGG - Intergenic
938576493 2:132609092-132609114 TTTGAAGCTCAGCTTCAGGAGGG + Intronic
939362527 2:141191349-141191371 GTTTAGGCTCAGATTGCAGAAGG - Intronic
940250491 2:151670270-151670292 TTTTAGCCCCAGATTTTGGAAGG - Intronic
941232174 2:162924271-162924293 CTTTATGCTCAGATCAAGGCAGG - Intergenic
942062272 2:172238861-172238883 TGGTAGACTCAGATGAAGGAAGG + Intergenic
942762165 2:179412022-179412044 TTTTAGGCTGGGAGTAAGGTTGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169279712 20:4256650-4256672 TTTCAGGCACTGATAAAGGAAGG - Intergenic
1177782433 21:25635393-25635415 TTTTAGGAGCAGTTTATGGAGGG - Intergenic
1182024603 22:27108193-27108215 TTTTAGGCTCAGACAATTGATGG + Intergenic
1183488171 22:38101186-38101208 TTTTAGGAGAAGATGAAGGAAGG - Intronic
950026553 3:9824265-9824287 TATTAGGCACAGATTAAGACAGG + Intronic
950677985 3:14566010-14566032 TTCTAGCCTCAGATGAAGAAAGG + Intergenic
951361425 3:21729125-21729147 TCTTTGGCAAAGATTAAGGAAGG + Intronic
954737922 3:52722107-52722129 TTATGGGCTCAGAATAAGGGAGG - Intronic
954878078 3:53816213-53816235 TACTAGGCCCAGAATAAGGACGG - Exonic
955552142 3:60096341-60096363 TTATAGGCTCAGAATAGGGGAGG + Intronic
955962502 3:64355287-64355309 TTTTATGCTGAAATTTAGGAGGG - Intronic
956349325 3:68317389-68317411 CTTTAGCCTTAGATTTAGGAAGG - Intronic
956661667 3:71604340-71604362 TTTTGGCCTCAGGTTAACGATGG - Intergenic
957726626 3:84074116-84074138 TCTTAGGAGCAGTTTAAGGAGGG + Intergenic
958449840 3:94259654-94259676 TTATAGGCTCAGAATGGGGAAGG - Intergenic
958837469 3:99162659-99162681 TTTTAGTATCATATGAAGGAAGG + Intergenic
959369271 3:105503627-105503649 TTTTTGGTTCATTTTAAGGATGG - Intronic
959792237 3:110375681-110375703 TTTAAGGCTCAGTTTTAGGCAGG + Intergenic
959978117 3:112484538-112484560 TTTCAGTCACACATTAAGGAAGG - Intronic
960095564 3:113686410-113686432 TTTTAGCATCATATCAAGGAAGG - Intronic
962893071 3:139689870-139689892 TTTTTGGCTGAGCTGAAGGAGGG + Intergenic
963380868 3:144528638-144528660 TTTTGGGCTAAGATTATAGAGGG - Intergenic
965239111 3:166171587-166171609 TTTTAGGAACCGATTATGGAGGG + Intergenic
965635290 3:170774496-170774518 TTTTAGGCTGGCATTAAGGAGGG - Intronic
965736068 3:171822477-171822499 TTATAGACCCAGATTAAAGACGG - Intergenic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
970926528 4:21458771-21458793 TTTTAAGCTGAGAATGAGGATGG - Intronic
971801083 4:31291933-31291955 TTTTGGACTCAGAATAATGATGG + Intergenic
972492141 4:39597827-39597849 TTTTCTGCTCACATTAATGAAGG + Intronic
972496308 4:39638430-39638452 TTTTAGGATCAGATTGTCGACGG - Intronic
972814868 4:42633064-42633086 TTTTGGCTGCAGATTAAGGAAGG - Intronic
974433970 4:61833649-61833671 TTTTAGGAGCAGGTTAGGGAGGG + Intronic
975092182 4:70417050-70417072 TTTTAGGCAGAGATTTTGGATGG - Intergenic
975896158 4:79093349-79093371 GTTTTGGCTCCGATTAAGGAAGG + Intergenic
976988164 4:91328067-91328089 TTTAAGGCTCAGAAGAAGGCAGG - Intronic
977658356 4:99551335-99551357 TTTTAAGCTGAGATAAAGGCAGG - Intronic
979426924 4:120579143-120579165 TTTTAGGCCCAGATTGTGTAGGG - Intergenic
979484722 4:121257429-121257451 TTTTAGGAGCAGTTTAAGGAGGG + Intergenic
981940908 4:150280720-150280742 ATATGGGCTCAGATTGAGGAAGG + Intronic
982008816 4:151087466-151087488 TTTTAGGAGCAGTTTAGGGAGGG - Intergenic
985152184 4:186959033-186959055 TTTCAGGTTGAGTTTAAGGAAGG - Intergenic
985653404 5:1117544-1117566 TTTTAGGAGCAGTTTAGGGAGGG - Intergenic
986212206 5:5684565-5684587 TCTTAGGAGCAGTTTAAGGAGGG + Intergenic
986863422 5:11954342-11954364 TGAGAGGCTCAGATTAAGGATGG - Intergenic
988463675 5:31466437-31466459 TTTGAGGCTGAGAGTCAGGATGG + Intronic
990032504 5:51278654-51278676 CTTTTGGCTCACATTCAGGATGG + Intergenic
990873261 5:60456698-60456720 TTGTAGACTGAGAGTAAGGAAGG - Intronic
992799368 5:80281759-80281781 TTTTAGGCTCAATTTAGGGTAGG + Intergenic
995320707 5:110830628-110830650 TTATAGGCTCAGAATGGGGAGGG - Intergenic
998371076 5:141661862-141661884 TTTTAGGCACAAATGCAGGATGG + Intronic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1003257100 6:4484019-4484041 GGTTAGGCTCACATTATGGAGGG + Intergenic
1003845016 6:10164194-10164216 GTTTAGGTTAAGTTTAAGGAAGG + Intronic
1004031889 6:11878595-11878617 TTTTAGCCTCTGGTCAAGGAAGG + Intergenic
1004359056 6:14954847-14954869 TTTTAGGAGCAGTTTAGGGAGGG - Intergenic
1005955190 6:30658756-30658778 TTTGGGGCTAAGATTAGGGAGGG - Intronic
1007315080 6:40981106-40981128 TTTTATGATAAGAATAAGGATGG - Intergenic
1009830497 6:68925383-68925405 TTATAGGCTCATATTTAGGCAGG - Intronic
1011379213 6:86724551-86724573 TTTTAGGCACAGATTCTTGAAGG + Intergenic
1011990079 6:93503786-93503808 TATTAGGCTCATATTAAGAGTGG - Intergenic
1015096940 6:129427110-129427132 GTTTAGACTCAGATTAAAAAAGG - Intronic
1015987780 6:138901904-138901926 TCTCAGGCTCAGATTTAGAATGG - Intronic
1016257754 6:142129299-142129321 TTTTAGTTTCAGATAAAGGAGGG - Intergenic
1016379476 6:143460208-143460230 CTTGAGGCTGAGATTAAGAAGGG + Intronic
1018735163 6:166682404-166682426 TTCTAGGCTCCGATGAAGTAGGG - Intronic
1019270593 7:145070-145092 ATTTAGGTTCAGAAAAAGGATGG + Intergenic
1020454396 7:8354876-8354898 CTTTAAGCTGAGATTAAGAAGGG - Intergenic
1021865721 7:24954984-24955006 TTTGAGGCTGTGATTATGGAGGG - Intronic
1027763251 7:82306600-82306622 TTTTTGCCACAGGTTAAGGATGG - Intronic
1028697960 7:93738758-93738780 TTTTAGGCCCGGAACAAGGAAGG - Intronic
1028914864 7:96247299-96247321 TTTTAAGCTTAGATAAATGATGG - Intronic
1029509555 7:100985381-100985403 TTTTAGGAGCAGTTTAGGGAGGG + Intronic
1029697612 7:102224482-102224504 TTTTAGACTCAGATTGAGAGTGG + Intronic
1030942629 7:115673121-115673143 TTTTAGTGTCAGAATCAGGAAGG + Intergenic
1031372419 7:120984420-120984442 GTTTAGGTACAGATCAAGGAGGG - Intergenic
1031597654 7:123666600-123666622 GTTTAGGCTCTGATTAATGTGGG + Intergenic
1036375507 8:8196074-8196096 TGCTAGGGGCAGATTAAGGAAGG - Intergenic
1036854026 8:12227075-12227097 TGCTAGGGGCAGATTAAGGAAGG + Intergenic
1036875398 8:12469573-12469595 TGCTAGGGGCAGATTAAGGAAGG + Intergenic
1038623492 8:29167786-29167808 TTTTAGCCTTTGATAAAGGACGG + Intronic
1038647760 8:29375128-29375150 TTTTAGGAGTAGATCAAGGAGGG - Intergenic
1038745145 8:30248478-30248500 TTTTAGGAGCAGTTTAGGGAGGG - Intergenic
1038886376 8:31667322-31667344 TTTGTGGCTCAGATTTGGGAGGG + Intronic
1038949608 8:32400142-32400164 TTTTAGGCTCGGGTTAATGTAGG - Intronic
1042590261 8:70391322-70391344 TTTTAGGCTCAGATTAAGGAGGG - Intronic
1045472854 8:102527836-102527858 TCTTAGGACCAGTTTAAGGAGGG - Intergenic
1045994063 8:108342592-108342614 TTTTAGGAGCAGTTTAGGGAGGG - Intronic
1047290982 8:123530430-123530452 TTTTAGGCTTAGAAGTAGGAGGG - Intronic
1050407232 9:5322287-5322309 TTTACTGCTCAGATTTAGGAAGG + Intergenic
1050414228 9:5398243-5398265 TTTACTGCTCAGATTTAGGAAGG + Intronic
1050930289 9:11313569-11313591 TTTTAGCATCATATCAAGGAAGG - Intergenic
1051770044 9:20567768-20567790 TTTTTGGCTCAGAGTCAAGAAGG + Intronic
1051791244 9:20804975-20804997 TAATAGGCACAGATTAAGAAGGG - Intronic
1055482821 9:76726563-76726585 TTTTACGCTCCAATTAAGGAGGG + Intronic
1056031700 9:82560240-82560262 TTTTGCCCTCAGTTTAAGGAGGG - Intergenic
1056391378 9:86144544-86144566 TCTTAGGAGCAGTTTAAGGAAGG + Intergenic
1056430839 9:86526501-86526523 TTTTAGGGTCAGATTAAAGAGGG + Intergenic
1186527597 X:10263656-10263678 ATTTAGGCTGACATTAAGAAAGG + Intergenic
1188235533 X:27726398-27726420 TTTTAGGAACACATTAAGGTAGG + Intronic
1188282219 X:28284351-28284373 TTTTTTGGTCAGGTTAAGGAAGG + Intergenic
1189116217 X:38345480-38345502 TTTTAGGAGCAGTTTAGGGAGGG + Intronic
1189245732 X:39561826-39561848 TTTTAGGCAGTGATTAAAGATGG + Intergenic
1190477146 X:50839776-50839798 ATTAAAGCTCAGATTCAGGATGG + Intergenic
1190480315 X:50870568-50870590 ATTAAAGCTCAGATTCAGGATGG - Intergenic
1195378060 X:104246725-104246747 TTTTATGGTCAAATTAAGCAGGG - Intergenic
1198050631 X:132949816-132949838 TTTTATGCTTAGATTTGGGAGGG + Intronic
1198444296 X:136696194-136696216 GTTTAGGCTCAGATCAGGCAAGG + Intronic
1198600613 X:138281349-138281371 TTTATTGCTCAGATTAAGTATGG - Intergenic
1198697524 X:139358316-139358338 TTTTATGTCCAGATTAAGGTCGG - Intergenic
1199064847 X:143403984-143404006 TTTTGGGTACATATTAAGGAAGG + Intergenic
1199523791 X:148768692-148768714 TCTAAGGCACAGATTAGGGAGGG + Intronic
1199807988 X:151320533-151320555 TTATGGCCTTAGATTAAGGAAGG - Intergenic
1200371858 X:155735495-155735517 TTTTAGGCACAGATACATGAAGG + Intergenic
1201534181 Y:15027644-15027666 TCTTAGGAGCAGATTAAGGAGGG - Intergenic