ID: 1042590568

View in Genome Browser
Species Human (GRCh38)
Location 8:70393874-70393896
Sequence GCCTGGACGTTGAAGGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042590568 Original CRISPR GCCTGGACGTTGAAGGGCAT TGG (reversed) Intronic
900205391 1:1429826-1429848 GCCTGGATGATGAAGGGAAGTGG - Intergenic
905890679 1:41516650-41516672 GCCTGAGGGCTGAAGGGCATGGG - Intronic
906290992 1:44619069-44619091 GGCTGGAGGTTGAAGGGCGGGGG + Intronic
908275469 1:62466405-62466427 GCCTGAACCTTGAAGGGAAAAGG + Intronic
908943726 1:69468622-69468644 GCTGGGAAGTTCAAGGGCATAGG + Intergenic
910597258 1:88993001-88993023 GCCTGGACGTGGCCGGGGATTGG + Intergenic
914335388 1:146710426-146710448 GCCTGGATGATGAAGGCCCTGGG - Intergenic
915907642 1:159890444-159890466 GACTGGACATAGAAGGGCAGGGG + Intronic
916671498 1:167025828-167025850 GCCAGGAAGGGGAAGGGCATGGG + Intergenic
917472210 1:175335409-175335431 GCCTGGTCGGTGAGGGGCACAGG - Intronic
919784784 1:201252249-201252271 GCCTGGGAGCTGGAGGGCATGGG - Intergenic
920249977 1:204617095-204617117 GCCTGGAGGGTGATGGGCATGGG - Intergenic
923265219 1:232307361-232307383 GCCTGGGCATGGAAGGGGATTGG - Intergenic
1064640662 10:17412248-17412270 GGCTGGAGGTTGGAGGGCCTGGG - Intronic
1070520886 10:77252402-77252424 GACTGCAGGCTGAAGGGCATTGG + Intronic
1073917674 10:108425526-108425548 GCCTGGAACTTGAGGGGCAAGGG + Intergenic
1074831680 10:117254086-117254108 GCCAGGTCGCTGCAGGGCATCGG + Exonic
1075220022 10:120576609-120576631 GGCTGGAGGATGAAGGGTATAGG + Intronic
1077609376 11:3635120-3635142 GGCAGGATGTTGAAGGGCACAGG - Intergenic
1080928960 11:36787400-36787422 GCCTGGACATCTAAGGGAATGGG + Intergenic
1084541637 11:69790652-69790674 GCCTGGAAGATGAAGTGCTTAGG + Intergenic
1084736970 11:71111649-71111671 GCCAGGAGGTTGAAGGGCCCAGG - Intronic
1085037838 11:73310382-73310404 TCCTGGACGATGAGGGGCAGCGG - Exonic
1087102812 11:94381422-94381444 GCCTGGATGTTGGGGGGCCTGGG + Intronic
1088740721 11:112764892-112764914 GCCCGGACTCTGAAGGGCAAAGG - Intergenic
1088845563 11:113663254-113663276 GCCTGGACAAGGAAGGGCATAGG + Intergenic
1089015342 11:115160870-115160892 GCCTGGAAGTGGAAGGGTGTAGG - Intergenic
1089738322 11:120564628-120564650 GCCTGGAGGTGGCCGGGCATCGG + Intronic
1090263436 11:125339116-125339138 GGCTGGAGGTTGAAGGGGACGGG + Intronic
1091196415 11:133734678-133734700 TCCTGAACGTTGACAGGCATGGG + Intergenic
1094045302 12:26159951-26159973 GTCTGGACCATGAAGGGGATTGG + Intronic
1094752868 12:33433823-33433845 TCCTTGGCGCTGAAGGGCATTGG - Intronic
1097794019 12:63843820-63843842 GCTTGGACGGAGAAGGGCACAGG + Intergenic
1102041398 12:109803182-109803204 GCCTGGAAGTTCAAGGTCATGGG - Intronic
1114611045 14:24040704-24040726 ACCTGGAAGTAGAGGGGCATGGG + Intergenic
1120635948 14:86951259-86951281 GCCTGTACTTTGAAGGGCTGAGG + Intergenic
1121429445 14:93876629-93876651 GCCTGGCCCCTAAAGGGCATTGG + Intergenic
1128793065 15:70447352-70447374 GCCTGTATGTTAAAGGGCAGTGG - Intergenic
1129167546 15:73787300-73787322 GCCTGGGAGGTGAGGGGCATGGG + Intergenic
1130375636 15:83326393-83326415 GCCTGAACCCTGAAGGGCATGGG + Intergenic
1132521069 16:389390-389412 AGCTGGAAGATGAAGGGCATGGG + Intergenic
1137605889 16:49786553-49786575 GCCTGGTGGCTGCAGGGCATAGG - Intronic
1139998235 16:71000802-71000824 GCCTGGATGATGAAGGCCCTGGG + Intronic
1142745067 17:1952296-1952318 GGCTGGACTTGGAGGGGCATGGG + Intronic
1143797819 17:9352072-9352094 GCCTGGAAGATGGAGGGCTTCGG + Intronic
1146842591 17:36166241-36166263 ACCTGGACGTAGAGGGGCCTTGG - Exonic
1150678915 17:67268607-67268629 GCCAGGACTATGAAGGTCATAGG - Intergenic
1152525227 17:80884622-80884644 TCCTGGACGCAGAGGGGCATGGG - Intronic
1155258996 18:24023308-24023330 GCCTGGACGTTCCAAGGCAAAGG - Intronic
1160888664 19:1365322-1365344 GCCTGGAAGTTGCAGGTCATTGG + Intronic
1166388853 19:42397650-42397672 GGATGGACGTTGATGGGCATGGG + Intergenic
1166911119 19:46158746-46158768 CCATGCACGTTGAAGGGTATTGG - Intronic
1166960927 19:46495409-46495431 GCCTGGACGTGGACGCGCACAGG - Exonic
1167737002 19:51300858-51300880 ACCTCGAAGTTGAAGGGCAAGGG + Intergenic
925338684 2:3117581-3117603 GCCTGGACTTTGATGGGAACAGG - Intergenic
932681412 2:73829043-73829065 GGTTGGACTTTGAAGGGGATCGG + Exonic
936502040 2:113074254-113074276 GCATGGAAGTGGAAGGGCTTGGG + Intronic
936911907 2:117602259-117602281 GCCTGGACTTGGGTGGGCATGGG - Intergenic
937045387 2:118848549-118848571 GTCTGGACCGGGAAGGGCATGGG - Intergenic
937711234 2:124982426-124982448 GCCTGCGTGTTGCAGGGCATTGG - Intergenic
937972407 2:127560716-127560738 TCCTGGACTCTGTAGGGCATGGG - Intronic
941355766 2:164489229-164489251 GCCTGGACAGTACAGGGCATGGG - Intergenic
945680486 2:212907905-212907927 GCCTGGACTATTAAGGACATTGG - Intergenic
945881416 2:215328538-215328560 ACCAGGACGGTGAAGGGCAGAGG - Intronic
947801872 2:232933769-232933791 GCCTAGACCTGGAAGGGCAAGGG - Intronic
948131999 2:235607749-235607771 TCCTGGAGGTGGAAGGGCAGCGG + Intronic
1174378756 20:50143094-50143116 GACTGGACGGTGCAGGGCAAAGG + Intronic
1175249013 20:57597738-57597760 CGCTGAGCGTTGAAGGGCATGGG + Intergenic
1177341679 21:19811268-19811290 ATCTGGATTTTGAAGGGCATTGG + Intergenic
1182010298 22:26995108-26995130 GCCTGGAGGGTGAAGGGATTCGG + Intergenic
1183102148 22:35590789-35590811 GGCTGGAGGGTGAAGGGCCTGGG + Intergenic
1184242548 22:43218822-43218844 GGCTGGACCTTGAAGGGCCTTGG - Intronic
953660988 3:44891431-44891453 GCCTGGATGATAAAGGGTATAGG - Intronic
994315957 5:98333403-98333425 GACTGGATGTTAAAAGGCATTGG + Intergenic
996339362 5:122419024-122419046 GCCTGAGCGATGAAGGGCAGGGG + Intronic
996347929 5:122507686-122507708 GCCTGGACCTGGGAGGCCATTGG - Intergenic
996760789 5:126984109-126984131 GCCTGGATTTCCAAGGGCATGGG + Intronic
1002640579 5:180628830-180628852 CCCTGGACTTGGAAGGGTATCGG + Intronic
1005169783 6:22969555-22969577 GCCTAGACTTTGAGGGGAATAGG - Intergenic
1008056503 6:46951220-46951242 GCCTGGAGGCAGAAAGGCATAGG + Intronic
1011745415 6:90403313-90403335 ACCTGGACATGGAGGGGCATTGG - Intergenic
1012835165 6:104255422-104255444 GCCTGGACATTGAGAGGCCTTGG + Intergenic
1013610442 6:111789400-111789422 GCCTGGGGGTTGATGGGGATTGG - Intronic
1017087708 6:150729781-150729803 GCCTGTACGTGGACTGGCATTGG + Intronic
1017333102 6:153222517-153222539 GCCTGGAGAATGATGGGCATGGG - Intergenic
1017537248 6:155361964-155361986 GACTGGAGGGTTAAGGGCATGGG + Intergenic
1017649264 6:156565999-156566021 GCCGGGACTTTAAAGGGCCTTGG - Intergenic
1024509650 7:50193622-50193644 GACTGGACGTGGAAGGGGCTGGG - Intergenic
1033763140 7:144459015-144459037 GCCTTCAAGTTGAAGGGCAGAGG - Intronic
1036594784 8:10201725-10201747 TTCTGGATGTTGAAGGGGATCGG - Intronic
1042590568 8:70393874-70393896 GCCTGGACGTTGAAGGGCATTGG - Intronic
1047569615 8:126083633-126083655 ACCTGGGAGGTGAAGGGCATAGG + Intergenic
1047925995 8:129683150-129683172 GCCTGGAAGTTGAAAGACTTGGG - Intergenic
1049202786 8:141350065-141350087 GCCTGGGGGCTGAAGGACATCGG - Intergenic
1051366019 9:16321996-16322018 GCCAGGATCTTGAAGGGCACAGG + Intergenic
1057261345 9:93586527-93586549 GCCTGTACGTTGGCTGGCATGGG - Intronic
1060297752 9:122354897-122354919 GCCTGGACCTTGAGGCACATGGG - Intergenic
1061914054 9:133739844-133739866 TCCTGGACGTGCAAGTGCATGGG + Exonic
1187654088 X:21449689-21449711 GCCTGGGCTTTGAAGTGAATAGG - Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189545010 X:42033656-42033678 GTTTGGAAGTGGAAGGGCATAGG + Intergenic
1189748068 X:44190330-44190352 TCCTGGACAATGAAGGGCAAAGG + Intronic
1190216542 X:48482666-48482688 GCCTGCACGTTGAAGAGGAAGGG + Exonic
1190544564 X:51512204-51512226 GGCTGGACGTTGCAGAGGATAGG - Intergenic
1192261637 X:69509167-69509189 GCCAGGGCGGGGAAGGGCATCGG - Intronic