ID: 1042593798

View in Genome Browser
Species Human (GRCh38)
Location 8:70424163-70424185
Sequence GGCCAGTGGTCTTAATGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042593792_1042593798 23 Left 1042593792 8:70424117-70424139 CCACAGACTTAGTGCTTCTTGGA 0: 1
1: 1
2: 1
3: 10
4: 149
Right 1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG 0: 1
1: 0
2: 5
3: 13
4: 78
1042593795_1042593798 -5 Left 1042593795 8:70424145-70424167 CCATAGTATGGCCACAGTGGCCA 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG 0: 1
1: 0
2: 5
3: 13
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042593798 Original CRISPR GGCCAGTGGTCTTAATGTGC TGG Intergenic
900676375 1:3889339-3889361 GGGCAGTGGGCTTAATGAGAGGG - Exonic
905099391 1:35505419-35505441 GGCAAGTGGTGTGTATGTGCAGG - Intronic
911569445 1:99505333-99505355 GGACGGTGGTCTAAATGTGTGGG - Intergenic
915470506 1:156123145-156123167 GGACAGTGGTCTGAATTTGACGG + Intronic
916383415 1:164239247-164239269 TGCCAGTGGTGTTAATGTTTGGG - Intergenic
917965863 1:180178152-180178174 GACCAGTTGTCTCCATGTGCTGG - Intronic
922661098 1:227430921-227430943 AGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1068368725 10:56086478-56086500 AGCCAGTGGTTTTAATGTGGAGG + Intergenic
1069557335 10:69406902-69406924 GGCCAGAGGGATTATTGTGCTGG + Intronic
1070361869 10:75698327-75698349 GGCCAGTGTTCTTACTTTGCTGG - Intronic
1075399904 10:122153381-122153403 GGCCAGTGTTCTGACTTTGCTGG - Intronic
1076395322 10:130134736-130134758 GGCCTGTGTTCTTAAAGGGCAGG - Intergenic
1080634385 11:34110766-34110788 GTCCTGTGGTCTTAAAGTGAAGG + Intronic
1084558505 11:69889520-69889542 GGCGAGTGATCTGAATGGGCAGG - Intergenic
1086496084 11:87405828-87405850 GGCCAATGGTATGAAAGTGCTGG - Intergenic
1093363418 12:18261138-18261160 AACCAGTGGTCTCAATTTGCAGG - Intronic
1099247117 12:80205918-80205940 TGCCAGTTGTTTTAATGTGTTGG + Intergenic
1099463682 12:82955982-82956004 GGCCAGTTTTCTTAATTTTCAGG + Intronic
1102864910 12:116366751-116366773 GGCCAGTGGCCATGCTGTGCTGG + Intergenic
1104141809 12:125994594-125994616 TGCCAGTGGTCTTTCTGTTCTGG + Intergenic
1107722439 13:43263060-43263082 TGCCAGTGCTCCTAATGTGAGGG + Intronic
1108474513 13:50800602-50800624 GGGCAGAAGTTTTAATGTGCGGG - Intronic
1113393962 13:109926474-109926496 GGCCAGTCATCTTAATCTGGAGG - Intergenic
1120165347 14:81193119-81193141 GTCCAGTGTTCTTCATGTGAAGG - Intronic
1121587277 14:95070871-95070893 GGGCAGTGGTCATAATGTCCGGG + Intergenic
1121941826 14:98078170-98078192 GGACAGTGGTGATGATGTGCAGG - Intergenic
1122295621 14:100704133-100704155 GGCCTGTGGTCTTCAGGAGCTGG - Intergenic
1202905226 14_GL000194v1_random:67853-67875 GGACTTTGGTCTTAATGTGAAGG + Intergenic
1125368182 15:38941730-38941752 GGCCAGTGTGCCTAATGAGCTGG + Intergenic
1128636460 15:69305558-69305580 GGCCACTGACCTTAGTGTGCGGG - Intronic
1128805652 15:70529131-70529153 GGCAAGTGGTCTGAATTGGCTGG + Intergenic
1137060943 16:35791354-35791376 GGGCAGTGGTCTCATTGTGGGGG - Intergenic
1142269139 16:89080055-89080077 GGCCACTGCTCTGATTGTGCAGG + Intergenic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1150540186 17:66088827-66088849 GGCCAGGGGCCTGAGTGTGCAGG - Intronic
1150703758 17:67469549-67469571 GGCCGCTGGTCTGAGTGTGCTGG - Intronic
1155123122 18:22842951-22842973 GGCCAAGGGTCTTAATCTGGGGG - Intronic
1162199380 19:9009748-9009770 GGGCAGGGGTCTTAAACTGCAGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1165490064 19:36118251-36118273 GGCCAGAGGACTGAATGTGAAGG + Intronic
926146474 2:10399641-10399663 GGCCAATGGTGTGAATGTGCTGG - Intronic
928130101 2:28642985-28643007 GGACAGTGGTCTGGAGGTGCAGG + Exonic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
931094544 2:58924484-58924506 GGCCAGTGTTCCAAATGTGGTGG + Intergenic
933779198 2:85789714-85789736 CTCAAGTGATCTTAATGTGCAGG + Intergenic
935089443 2:99880568-99880590 GGCCAGGGGTCCTAGTGTGAGGG - Intronic
935182607 2:100704289-100704311 GGCCAGTGTTCATAAACTGCTGG + Intergenic
936484552 2:112915068-112915090 TGTGAGTGGTCTTAAGGTGCTGG - Intronic
937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG + Intronic
938391798 2:130912473-130912495 AGCCAGTGCTCTTAAGGTGCAGG - Intronic
938593308 2:132761373-132761395 GACCAGTGGTCCCAGTGTGCTGG - Intronic
941286330 2:163617686-163617708 TGCCAGTGGTCTTATTCTACAGG - Intronic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1170370346 20:15640989-15641011 GGCCAGTGGGCTCAATGCCCTGG + Intronic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1173853950 20:46237725-46237747 GGCCAGTGGTCATAAACTGGGGG + Intronic
1176049240 20:63107928-63107950 GGGCAGTGGTCTCCATGTCCTGG - Intergenic
1177282695 21:19004219-19004241 GGCCAATGATCTGAATGAGCTGG + Intergenic
1179213346 21:39345808-39345830 GGTGATTGGTCTTAATGTGAGGG - Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183609681 22:38891228-38891250 GAACAGTGGTCTTATTCTGCTGG + Intergenic
951673438 3:25210347-25210369 GGCCTGTGGTCATAATTTGCTGG - Intronic
956089578 3:65651540-65651562 GCAAAGTGGGCTTAATGTGCAGG - Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
961811242 3:129523116-129523138 GGCCAGTGTTCTGGATCTGCAGG - Intergenic
963487719 3:145957213-145957235 GACCAGTGGTCTAAGAGTGCAGG - Intergenic
963946091 3:151146895-151146917 GGCCAGTGGTCTGACTCTGCTGG + Intronic
969395901 4:6921111-6921133 TGCCAGTGTTCTCAGTGTGCTGG + Intronic
972606938 4:40622384-40622406 GCCCTGTGGTATGAATGTGCTGG + Intronic
973912025 4:55591216-55591238 TCCCAGTGGTTTTAATCTGCAGG + Intronic
974456173 4:62131317-62131339 GGCCAGTGGTGTTCCTGTGCTGG - Intergenic
983317840 4:166154817-166154839 GGCCAGAGGCCTTAATGTAGTGG + Intergenic
987361998 5:17115785-17115807 GGCCACTGGTCTTAATGCCCAGG + Intronic
995782593 5:115794260-115794282 GGGCAGTGGTGGTTATGTGCAGG - Intergenic
995782689 5:115794968-115794990 GGGCAGTGGTGGTTATGTGCAGG + Intergenic
997643150 5:135462944-135462966 GGAAAGTGGTCCTAATGTTCAGG + Intergenic
998880258 5:146638196-146638218 GGCCACTGGCCCCAATGTGCTGG - Intronic
999257633 5:150218582-150218604 GGCCTGTGTTCTTACTGTGAAGG + Intronic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1022599786 7:31746920-31746942 GGCCAGAGGTCCAAATGTGTGGG + Intergenic
1032632785 7:133671738-133671760 TGCCAGTGGGTTTAATGTGCAGG + Intronic
1035014003 7:155748017-155748039 GGGCTGTGGTCTTAATGCTCAGG + Intronic
1041007137 8:53506614-53506636 GACCAGTTGTTTTAATTTGCAGG - Intergenic
1042364199 8:67917672-67917694 GGCCAGTGGTGACAATGTGGTGG - Intergenic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1054830776 9:69622208-69622230 GGCAAGTGGGCTTATTCTGCTGG - Intronic
1056045230 9:82707814-82707836 TGACATTGGTCTTAATGTGCTGG + Intergenic
1057914922 9:99048074-99048096 GGCCTGTGGACTGAATGTTCAGG + Intronic
1061206087 9:129164278-129164300 GGCCAGTGGCCTTCTTGTTCTGG + Intergenic
1062160656 9:135077819-135077841 GGCCAGTTATCCTAATGTGTTGG + Intronic
1190152092 X:47957291-47957313 GGCCTGTGGTGTTGATTTGCTGG + Intronic
1190152367 X:47958803-47958825 GGCCCGTGGTGTTGATTTGCTGG + Intronic
1190777402 X:53564096-53564118 GGCCTGTGGTCCTAAGCTGCTGG - Intronic
1195870666 X:109481902-109481924 TGCCAGTGGTCTGCATGCGCAGG - Exonic
1195973010 X:110494161-110494183 AGTCAGTGGTCTTAAAGTTCAGG - Intergenic
1199876036 X:151929248-151929270 GCCCTGTGATCTGAATGTGCAGG + Intergenic