ID: 1042613137

View in Genome Browser
Species Human (GRCh38)
Location 8:70619576-70619598
Sequence CAGCAATCACAGATAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042613133_1042613137 23 Left 1042613133 8:70619530-70619552 CCAAGGACTGTGGGCATATCTAG 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1042613137 8:70619576-70619598 CAGCAATCACAGATAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042613137 Original CRISPR CAGCAATCACAGATAGAGGA AGG Intronic
No off target data available for this crispr