ID: 1042614939

View in Genome Browser
Species Human (GRCh38)
Location 8:70638372-70638394
Sequence AGGGCCAGTGGACCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042614939_1042614947 30 Left 1042614939 8:70638372-70638394 CCAGCTTGTGGTCCACTGGCCCT 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1042614947 8:70638425-70638447 CCAACTTAAAGTGATATTCATGG 0: 1
1: 0
2: 1
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042614939 Original CRISPR AGGGCCAGTGGACCACAAGC TGG (reversed) Intronic
900094995 1:936625-936647 AGGCCCTGTGGACCCCAGGCAGG + Intronic
900366071 1:2312498-2312520 ATGGCCAGGGGCCCCCAAGCTGG + Intergenic
902807001 1:18867353-18867375 AGGGACAGGGGACAACAAGCAGG + Intronic
902822716 1:18953206-18953228 ATGGCCAGGGGATCAGAAGCGGG + Intronic
903738003 1:25542669-25542691 ATGGCCAGTGGGCCACAGGTTGG - Intergenic
904289142 1:29472370-29472392 AGTCCCAGTGGACCACAAGTCGG + Intergenic
906099816 1:43253078-43253100 AAGCCCAGTGGATCCCAAGCAGG + Intronic
908006469 1:59733938-59733960 AGGGCCAGGGGACATCAAGGTGG - Intronic
912167757 1:107060373-107060395 GGTGCCATTGGACCACAGGCAGG + Intergenic
914345642 1:146796239-146796261 AGGCCCAGTGGTCCACAGGCTGG + Intergenic
916440451 1:164819699-164819721 TTGGCCAGGGGACCACAAGATGG - Intronic
916938446 1:169655955-169655977 AGGGCCAGTGGCTGACAAGATGG + Intergenic
917864877 1:179184773-179184795 AGGGCAAGTGAGCCACAAGAGGG - Intronic
920791380 1:209096315-209096337 AGTGCCAGTAGCCCACAGGCTGG + Intergenic
1063194293 10:3726818-3726840 AGGGCCAGTGGACAGGAAGATGG - Intergenic
1063304356 10:4883285-4883307 TGGGCTGGTGGATCACAAGCTGG - Intergenic
1064169367 10:13016670-13016692 AGAGCCAGGGGACCACAGGCAGG - Intronic
1065937271 10:30531849-30531871 AGGACCAGGTGACCAAAAGCTGG + Intergenic
1067289390 10:44930143-44930165 AGGGGCAGGGGACCCCAGGCTGG - Intronic
1069993434 10:72328773-72328795 AGGGCCTGGGCACCACAACCTGG - Intergenic
1070164764 10:73889161-73889183 AGGCCCAGTGGCCCACAGGCAGG - Intergenic
1073281876 10:102360435-102360457 AGGGCCAGGGGAACACAGGGAGG + Intronic
1074343316 10:112655774-112655796 AAGGCCAGTGGCCCATAAGAAGG + Intronic
1076413325 10:130267056-130267078 AGGCCCAGAGCACCAAAAGCTGG - Intergenic
1077144750 11:1039948-1039970 AGGGGCAGGGGGCCACCAGCAGG - Intergenic
1079129765 11:17740711-17740733 AGTGCCAATGGCCCCCAAGCTGG + Intronic
1080981528 11:37412780-37412802 AGGTCAAGTGCACCACAAGTAGG - Intergenic
1081781379 11:45715504-45715526 AGGGGCAGTGGGCCACAGGAGGG - Intergenic
1086616431 11:88826518-88826540 AGGGCCAATGGACCAGCATCTGG + Intronic
1086949694 11:92879344-92879366 AGGGCCAGAGGACAACATTCAGG + Intronic
1087772417 11:102225250-102225272 AAGGCAAGTGGACCACCACCTGG + Intronic
1089707151 11:120286937-120286959 AGCCACAGTGGACCACAAGCAGG + Intronic
1090086632 11:123655521-123655543 ACGGTGAGTGGACCAGAAGCAGG + Intergenic
1097298654 12:57994978-57995000 AAAGCCAGTGGACCAAAAGGTGG - Intergenic
1102001283 12:109559434-109559456 AGGTCCAGTGGTACAAAAGCTGG - Intronic
1102234744 12:111287274-111287296 AGGGCCCCTGGGCCACGAGCCGG + Intronic
1107479425 13:40772990-40773012 AGGGCCAGTTTTCCAAAAGCAGG - Intergenic
1109176303 13:59161181-59161203 AGAGCCAGTGGAGCATAAGTTGG + Intergenic
1112486191 13:99821944-99821966 TTGGCCAGTGGAACACATGCAGG + Intronic
1113376202 13:109766824-109766846 AGTGCCAGTGGGTCACATGCAGG - Intronic
1117000373 14:51365467-51365489 TGGTGCAATGGACCACAAGCAGG + Intergenic
1117817279 14:59611239-59611261 GGGGCCATTGAACCACAGGCAGG - Intronic
1119780347 14:77272853-77272875 AGGTCCACGGGACCCCAAGCTGG - Intergenic
1119788807 14:77331221-77331243 AGGGCCACAGGAGCAGAAGCTGG + Exonic
1121285897 14:92735594-92735616 AGGACAAGTGGACCAGAGGCTGG - Intronic
1121432392 14:93896924-93896946 GGGGACAGTGAACCACAAGACGG + Intergenic
1121857365 14:97282407-97282429 AGGGCAAGTGGAGCATAAACAGG - Intergenic
1122258859 14:100500477-100500499 AAGGCCAGTGCACCACAAAGTGG + Intronic
1122832295 14:104405012-104405034 AAGCACAGTGGACCACATGCTGG - Intergenic
1122999554 14:105285940-105285962 AGTGCCAGTTCACCACAAACTGG - Intronic
1124706453 15:31970431-31970453 GGGGCCAATGGAGCCCAAGCGGG + Intergenic
1126220258 15:46205158-46205180 AGGGCAAATGGACCAAAAGTAGG - Intergenic
1127972829 15:63975137-63975159 AGCCCCAGTGGAGCACATGCTGG - Intronic
1128262367 15:66241256-66241278 AGGGGCAGTGGACCAGGAGGAGG + Intronic
1128511440 15:68316209-68316231 AGGGCCAGTGGCCACCCAGCAGG + Intronic
1128638514 15:69318429-69318451 ATACCCAGTGGACCACGAGCAGG - Intronic
1131230699 15:90656897-90656919 AGAGCCAGTGGACTCCAACCTGG - Intergenic
1132646086 16:999916-999938 AGGGCCAGGGAAGCACCAGCAGG - Intergenic
1139988344 16:70919028-70919050 AGGCCCAGTGGTCCACAGGCTGG - Intronic
1140237748 16:73174080-73174102 ACGTCCAGTGAACCTCAAGCCGG - Intergenic
1140482196 16:75267648-75267670 AGGAACAGTGGGCCCCAAGCAGG - Intronic
1142914417 17:3124326-3124348 AGGGCAAGTGGATCAGAACCTGG - Intergenic
1144485409 17:15660280-15660302 AGGGCCAGAGGACAATGAGCCGG + Intronic
1144827711 17:18115707-18115729 AGGGCCTGTGGGCCACAATGAGG - Intronic
1148959926 17:51384732-51384754 CGGGCCAGTGGCACACAGGCAGG - Intergenic
1149771860 17:59328762-59328784 AGGGCCTGTGGGCCACCAGAAGG + Intergenic
1150096569 17:62381452-62381474 AGGGCTTATGGACCAGAAGCTGG - Intronic
1150336060 17:64331729-64331751 ATGGTCAGTGGCCCACATGCTGG + Intronic
1150651621 17:67014052-67014074 AGGGCCAGGAGACCACTAGCGGG - Intronic
1150657503 17:67049803-67049825 AGGGCAGCTGGACCAGAAGCTGG + Intronic
1153048878 18:882538-882560 AGGGACAGTGGATTTCAAGCAGG + Intergenic
1159934628 18:74353356-74353378 AGTAGCAGTGGACCACAAGGTGG + Exonic
1161067809 19:2247204-2247226 TGGCCCAGTGGAGCCCAAGCAGG - Intronic
1161154269 19:2724038-2724060 AGGGCAAGAGGATCACAAGGGGG - Intronic
1161329936 19:3681881-3681903 GGGGCCAGAGGACCAAACGCAGG - Intronic
1161735837 19:5991673-5991695 ATGGCCTGCGGACCTCAAGCGGG + Intergenic
1162015689 19:7845376-7845398 ATGGCCAGGGGACCCCTAGCAGG - Intronic
1163187989 19:15653069-15653091 AGGAGCAGAGGACCACAGGCAGG + Intronic
1163216903 19:15885785-15885807 AGGAGCAGAGGACCACAGGCAGG - Intronic
1164811626 19:31161923-31161945 ATGGCCAGTGGGCCACATCCAGG - Intergenic
1166348649 19:42182907-42182929 AGGGCCCTGAGACCACAAGCGGG + Intronic
925274259 2:2637660-2637682 AGGGGCAGTGGAGCACCAGAGGG + Intergenic
928124337 2:28605468-28605490 AGGACCAGCAGACCAAAAGCTGG + Intronic
932607865 2:73176510-73176532 AGGGCCAGAGGAACTCTAGCTGG - Intergenic
935901756 2:107800160-107800182 GGTGCCAGTGGTCCTCAAGCTGG - Intergenic
937829424 2:126403364-126403386 AGGGCCAGCGGACCAGGAGGAGG + Intergenic
939594077 2:144103296-144103318 GGGGCCACTGGAGCACAAGAGGG + Intronic
940400192 2:153240450-153240472 AGGGCTACTGAACCACAAGCAGG - Intergenic
941000819 2:160202094-160202116 AGGGCAAGTGGAATACAAGAAGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946320329 2:218950273-218950295 AGGCACTGTGGACCACAACCCGG - Intergenic
946339415 2:219058367-219058389 AGGGCCAGGGAACCAGAAACCGG + Intronic
947869361 2:233424591-233424613 AGGGCCAGTGGGCCGGAGGCAGG - Intronic
948861920 2:240756888-240756910 AGGGCCAGCCGCCCCCAAGCAGG - Intronic
948922083 2:241070591-241070613 AGGGCCAGGAGGCCACAGGCAGG + Intronic
1171309488 20:24135004-24135026 AGGGACAGTGGAGCAGAGGCTGG + Intergenic
1175591170 20:60193362-60193384 AGGGGCACTGGAACTCAAGCTGG - Intergenic
1176193949 20:63828322-63828344 ACGGCAAGAGGACCACAATCAGG + Intronic
1177120603 21:17132848-17132870 TGGGTCAGGGGAACACAAGCTGG + Intergenic
1179464360 21:41561904-41561926 TGGGCCAGAGGAGCACTAGCAGG + Intergenic
1180210983 21:46295456-46295478 AGGGCCTGTGGACCCTGAGCAGG - Intronic
1181856930 22:25788500-25788522 TGGAGGAGTGGACCACAAGCTGG + Intronic
949403421 3:3689273-3689295 ACTGCCAGTAAACCACAAGCTGG + Intergenic
950510920 3:13426056-13426078 AGGGCCTGGGGACCACAAGCAGG - Intergenic
952902226 3:38117874-38117896 AGGGCCTGGAGACCATAAGCCGG - Exonic
954448700 3:50560268-50560290 AGGGCCAGAGCACCATGAGCAGG - Intronic
962876504 3:139539547-139539569 GGAGCCAGTTGGCCACAAGCGGG + Exonic
964767436 3:160192410-160192432 AGTGCCAGTGGCTCAGAAGCTGG - Intergenic
965789617 3:172373367-172373389 AGGGCCTGTGGTGCATAAGCAGG + Intronic
966935666 3:184707057-184707079 AGGCCCAGTGAACCACGGGCAGG - Intergenic
969527525 4:7711490-7711512 ATGGCCGGAGCACCACAAGCTGG + Intronic
969645776 4:8428147-8428169 AGGGCCGGTGGCCCACGTGCTGG - Intronic
969705392 4:8788840-8788862 AGAGACAGAGGACCACAGGCTGG + Intergenic
971101888 4:23475899-23475921 TGGGCCAGTGAACCAGAATCTGG - Intergenic
977147140 4:93458058-93458080 TGGGCCAGTGGTCCTCAATCAGG - Intronic
980172727 4:129309478-129309500 AGAGGCATTGGACCACCAGCTGG + Intergenic
981748722 4:148073777-148073799 AGGGCCACCCTACCACAAGCGGG + Intergenic
982278240 4:153658691-153658713 GGGGCATCTGGACCACAAGCAGG + Intergenic
984334060 4:178364293-178364315 AAGGCCTGTGGAGCCCAAGCAGG + Intergenic
985727693 5:1524455-1524477 AGGTCGAGTGGACCTCAGGCGGG - Intergenic
989020809 5:37004981-37005003 CGGGCCAGTGGGCCACAGGTTGG - Intronic
994099591 5:95878611-95878633 GTGGCCAGTGGACCTCAAACTGG - Intergenic
997475442 5:134139806-134139828 AGGGCAAGTGGGCCACAGGTTGG - Intronic
1000955709 5:167540998-167541020 AGGGCAAGTGGCCCAGAAGTGGG + Intronic
1001016906 5:168150036-168150058 AGGGGGAGGGGACCACAAGGGGG - Intronic
1007394257 6:41568650-41568672 AGGGTCTGTGGACCACACGCTGG + Intronic
1007767592 6:44170082-44170104 AGGGACAGGGGAACAGAAGCAGG - Intronic
1007904761 6:45448488-45448510 AGGGCCAGGAGACCACGATCTGG + Intronic
1010560858 6:77347989-77348011 AGACCCAGTGGACTACTAGCAGG - Intergenic
1014189303 6:118474548-118474570 AGAACCAGTGCCCCACAAGCTGG - Intronic
1017239036 6:152147077-152147099 AGGCCCTGAGGACCACAAGAGGG - Intronic
1018003518 6:159600071-159600093 AGGGCCAGAGGAGCAGAGGCAGG + Intergenic
1018974268 6:168552992-168553014 AGGGCCCGTGGAACATATGCTGG - Intronic
1019567673 7:1692634-1692656 AGGGCCAGCGGCCCACCTGCCGG + Intronic
1021594428 7:22299975-22299997 AGGTCCAGTGAACCCCAAACAGG - Intronic
1021784620 7:24139553-24139575 ACTGCCAGTGGACCACAATGGGG - Intergenic
1022098814 7:27157120-27157142 AGGTCCAGTGGGCGACAGGCCGG + Intronic
1024678709 7:51661328-51661350 ATGGCGAGAGGAGCACAAGCTGG + Intergenic
1030185550 7:106758339-106758361 GGGGCCAGTGAACTACCAGCTGG + Intergenic
1030839223 7:114327962-114327984 AGTGCCACTGGACTCCAAGCTGG - Intronic
1034348954 7:150404356-150404378 CGGTGCAGTGGAACACAAGCTGG + Intronic
1042614939 8:70638372-70638394 AGGGCCAGTGGACCACAAGCTGG - Intronic
1045521462 8:102906442-102906464 ATGGCCATTGGACCACATTCTGG - Intronic
1047803171 8:128331036-128331058 AGGGCCAGAGGACAGCAAGGAGG + Intergenic
1049636842 8:143693621-143693643 AGAGCCAGTGGCCCACAGCCAGG - Intronic
1049695701 8:143983446-143983468 AGGCCGAGTGCACCACCAGCTGG + Exonic
1056682885 9:88734880-88734902 AGGTTCAGTGAACCACAAGCAGG - Intergenic
1056877586 9:90349525-90349547 AGGACCACTGGGCCAGAAGCTGG - Intergenic
1060954624 9:127629700-127629722 AGGTCCTGTGGACCACCTGCGGG + Intronic
1186101622 X:6163539-6163561 GGAGGCAGTGGACCACAGGCTGG - Intronic
1187386406 X:18852556-18852578 GAGGCCTGTGGACCAGAAGCCGG + Intergenic
1195525372 X:105883051-105883073 AGGGCCAGTTGATCACAGACTGG - Intronic
1198533668 X:137567219-137567241 AGGGCACGTGGACAACAACCAGG + Exonic