ID: 1042620789

View in Genome Browser
Species Human (GRCh38)
Location 8:70701451-70701473
Sequence TCTGTTTCTCTCTTAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042620785_1042620789 18 Left 1042620785 8:70701410-70701432 CCTGGATGTTTCATTCGAAGATG 0: 1
1: 0
2: 4
3: 124
4: 276
Right 1042620789 8:70701451-70701473 TCTGTTTCTCTCTTAGAGCCAGG No data
1042620784_1042620789 30 Left 1042620784 8:70701398-70701420 CCAATGTGAGTACCTGGATGTTT 0: 14
1: 46
2: 108
3: 149
4: 276
Right 1042620789 8:70701451-70701473 TCTGTTTCTCTCTTAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042620789 Original CRISPR TCTGTTTCTCTCTTAGAGCC AGG Intronic
No off target data available for this crispr