ID: 1042622081

View in Genome Browser
Species Human (GRCh38)
Location 8:70717543-70717565
Sequence AGTTGTTTCAGCTCTAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042622081_1042622086 3 Left 1042622081 8:70717543-70717565 CCATAGCTAGAGCTGAAACAACT No data
Right 1042622086 8:70717569-70717591 ATGCAGGGAACCATGTCCTGAGG No data
1042622081_1042622092 20 Left 1042622081 8:70717543-70717565 CCATAGCTAGAGCTGAAACAACT No data
Right 1042622092 8:70717586-70717608 CTGAGGCTGCATAGAGCAGGGGG No data
1042622081_1042622088 17 Left 1042622081 8:70717543-70717565 CCATAGCTAGAGCTGAAACAACT No data
Right 1042622088 8:70717583-70717605 GTCCTGAGGCTGCATAGAGCAGG No data
1042622081_1042622089 18 Left 1042622081 8:70717543-70717565 CCATAGCTAGAGCTGAAACAACT No data
Right 1042622089 8:70717584-70717606 TCCTGAGGCTGCATAGAGCAGGG No data
1042622081_1042622091 19 Left 1042622081 8:70717543-70717565 CCATAGCTAGAGCTGAAACAACT No data
Right 1042622091 8:70717585-70717607 CCTGAGGCTGCATAGAGCAGGGG No data
1042622081_1042622094 28 Left 1042622081 8:70717543-70717565 CCATAGCTAGAGCTGAAACAACT No data
Right 1042622094 8:70717594-70717616 GCATAGAGCAGGGGGCTCCTGGG No data
1042622081_1042622093 27 Left 1042622081 8:70717543-70717565 CCATAGCTAGAGCTGAAACAACT No data
Right 1042622093 8:70717593-70717615 TGCATAGAGCAGGGGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042622081 Original CRISPR AGTTGTTTCAGCTCTAGCTA TGG (reversed) Intronic