ID: 1042622094

View in Genome Browser
Species Human (GRCh38)
Location 8:70717594-70717616
Sequence GCATAGAGCAGGGGGCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042622081_1042622094 28 Left 1042622081 8:70717543-70717565 CCATAGCTAGAGCTGAAACAACT No data
Right 1042622094 8:70717594-70717616 GCATAGAGCAGGGGGCTCCTGGG No data
1042622087_1042622094 -8 Left 1042622087 8:70717579-70717601 CCATGTCCTGAGGCTGCATAGAG No data
Right 1042622094 8:70717594-70717616 GCATAGAGCAGGGGGCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042622094 Original CRISPR GCATAGAGCAGGGGGCTCCT GGG Intronic