ID: 1042624990

View in Genome Browser
Species Human (GRCh38)
Location 8:70748257-70748279
Sequence ACATCTGCGCCCAGGAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042624990_1042624993 5 Left 1042624990 8:70748257-70748279 CCTGTGCTCCTGGGCGCAGATGT 0: 1
1: 0
2: 1
3: 36
4: 232
Right 1042624993 8:70748285-70748307 CCCAGCTGCAGCTCTAGACCTGG No data
1042624990_1042624995 6 Left 1042624990 8:70748257-70748279 CCTGTGCTCCTGGGCGCAGATGT 0: 1
1: 0
2: 1
3: 36
4: 232
Right 1042624995 8:70748286-70748308 CCAGCTGCAGCTCTAGACCTGGG No data
1042624990_1042624997 24 Left 1042624990 8:70748257-70748279 CCTGTGCTCCTGGGCGCAGATGT 0: 1
1: 0
2: 1
3: 36
4: 232
Right 1042624997 8:70748304-70748326 CTGGGCATCCCTGCACTCGCAGG No data
1042624990_1042624998 25 Left 1042624990 8:70748257-70748279 CCTGTGCTCCTGGGCGCAGATGT 0: 1
1: 0
2: 1
3: 36
4: 232
Right 1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG No data
1042624990_1042624999 26 Left 1042624990 8:70748257-70748279 CCTGTGCTCCTGGGCGCAGATGT 0: 1
1: 0
2: 1
3: 36
4: 232
Right 1042624999 8:70748306-70748328 GGGCATCCCTGCACTCGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042624990 Original CRISPR ACATCTGCGCCCAGGAGCAC AGG (reversed) Intronic
900257501 1:1704705-1704727 GCATCTGCGCCCGGGTGCAGGGG - Intronic
900383200 1:2395562-2395584 ACGCATGGGCCCAGGAGCACAGG - Intronic
900960313 1:5914942-5914964 ACAGCTAGGCCCAGGAGGACAGG - Intronic
901730241 1:11273645-11273667 ACTTCTGCCTCCAGGAGCGCTGG - Exonic
901826379 1:11864452-11864474 TCACCTGAGCCCAGGAGCCCAGG + Intergenic
902686137 1:18078868-18078890 ACATGTGCTCCCATGTGCACAGG - Intergenic
902817168 1:18922945-18922967 CCATCCCTGCCCAGGAGCACAGG + Intronic
903122884 1:21227812-21227834 ACATCTGCAACCTGAAGCACTGG + Intronic
903237097 1:21957113-21957135 AGATCTGAGCTCAGGAGCACTGG + Intergenic
903400914 1:23047612-23047634 ACATCTGAGGCCAGGCGCATTGG + Intronic
903781461 1:25822811-25822833 AGATCTGCGGCCAGGCGCAGTGG - Intronic
903788363 1:25875799-25875821 AGCTCTGCGCCGAGGAGCCCCGG - Intergenic
903926305 1:26833324-26833346 ACATCTGAGCAAAGAAGCACCGG + Intronic
904002674 1:27347794-27347816 TCACCTGCGCCCAGGAGACCAGG + Exonic
905243098 1:36593978-36594000 ACAGCTGCCCCCAACAGCACAGG - Intergenic
905694247 1:39963132-39963154 ATCCCTGCACCCAGGAGCACTGG + Intronic
906016501 1:42586389-42586411 TCATCTGAGCCCAGGAGTTCAGG - Intronic
907400894 1:54224096-54224118 ACTCCTGCTCCAAGGAGCACAGG + Intronic
912008505 1:104932540-104932562 GCAGCTGTGCCCAGGAGCACGGG - Intergenic
912648980 1:111421511-111421533 ACATCTGCCCCCCTGAGCTCAGG - Intronic
914906642 1:151751662-151751684 AGATATGAGCCCAAGAGCACAGG - Intergenic
915117617 1:153610555-153610577 CCACCTGCTCCCAGGAGTACTGG + Intronic
919249261 1:195031029-195031051 GTAGCTGTGCCCAGGAGCACAGG + Intergenic
919631717 1:199966056-199966078 TCATTTGAGCCCAGGAGCCCAGG - Intergenic
920508546 1:206534130-206534152 ACCTCAGCACCCAGGACCACTGG - Intronic
1063227532 10:4029952-4029974 ACATCTGCGTCCAGTAGGCCAGG + Intergenic
1063382861 10:5597150-5597172 GCATGTGCTCCCAGGGGCACTGG + Intergenic
1066188791 10:33036852-33036874 GCAGCTGCGCCCGGGAGCACAGG - Intergenic
1067016369 10:42758693-42758715 CCAGCTGGGACCAGGAGCACTGG + Intergenic
1067126354 10:43519133-43519155 ACATTTGAGCCCAGGAGTCCAGG - Intergenic
1067434956 10:46270224-46270246 ATCTCTGGGCCCAGGAGTACAGG + Intergenic
1068919149 10:62465000-62465022 GCATCTGCACCCGGGAGCACAGG - Intronic
1069403094 10:68070317-68070339 ACATCTTAGGCCAGGAGCAGTGG + Intronic
1070020708 10:72582862-72582884 TCATCTGAGCCCAGGAGTTCTGG + Intronic
1070569753 10:77632019-77632041 ACGTCTTTGCCCAGGATCACAGG + Intronic
1071605115 10:86980516-86980538 ACAGCTGGGACCAGGAGCACTGG + Intronic
1073761404 10:106632420-106632442 TCATTTGAGCCCAGGAACACCGG - Intronic
1074850085 10:117432544-117432566 AAATCAGCTCCCAGGAGCAGAGG - Intergenic
1075055154 10:119212911-119212933 TCATTTGAGCCCAGGAGTACTGG + Intronic
1078211859 11:9276295-9276317 AGATCTGGGACCAGGAGCAGTGG - Intergenic
1079673931 11:23202164-23202186 GCAGCTGCACCCAGGAGCAAGGG - Intergenic
1080706606 11:34701351-34701373 ACAGCTGCACCTGGGAGCACGGG - Intergenic
1081494263 11:43590830-43590852 AAATCTGTGGCCAAGAGCACTGG + Intronic
1083614310 11:64018794-64018816 GCAGGTGGGCCCAGGAGCACTGG + Intronic
1083923521 11:65792849-65792871 ACCTCTTCTCCCAGGAGGACAGG - Intronic
1084408800 11:68994232-68994254 ACACCTGCGCCAAGGGGCATAGG - Intergenic
1085390833 11:76181409-76181431 GCATCTGTGCCCAGGCGCACTGG + Intergenic
1088565030 11:111162346-111162368 ACATGTGCCTCCAGGAGCTCAGG + Intergenic
1090029497 11:123195096-123195118 CCATCTGCCCCCAGGGGCACGGG - Exonic
1090648542 11:128786608-128786630 ACATCTGCAGCCTGGAGGACGGG - Intronic
1091287953 11:134419006-134419028 ACATCTGTGGTAAGGAGCACAGG + Intergenic
1091883985 12:4002882-4002904 AAATCTGTGCCCAGTGGCACTGG + Intergenic
1092856357 12:12677562-12677584 ACATCTGTGGCCAGGCGCAGTGG - Intronic
1094665794 12:32519500-32519522 AAATCTTCGGCCAGGTGCACTGG + Intronic
1097245855 12:57607250-57607272 ACTTCTGCCCCCAGGAGCTCGGG + Exonic
1097684127 12:62676436-62676458 GCACCTGCACCCAGGAGGACAGG - Intronic
1100491646 12:95085489-95085511 AGAGCTGCCCCCAGGTGCACTGG - Intronic
1103173559 12:118843266-118843288 GCAGCTGCGTCCAGGAGCACAGG - Intergenic
1105513259 13:21068846-21068868 TCACCTGAGCCCAGGAGTACGGG - Intergenic
1105591854 13:21799798-21799820 ATATCTGAGCCCAGGACCTCTGG + Intergenic
1108017107 13:46087077-46087099 GCAGCTGCGCCCAGGAGGGCAGG + Intronic
1108195711 13:47992940-47992962 AAATCTGTGCCCAGGCGCAGTGG + Intronic
1108301792 13:49084914-49084936 ATAACTGCCCCCAGAAGCACCGG - Intronic
1108559527 13:51628502-51628524 GCAGCTACACCCAGGAGCACCGG + Intronic
1110439229 13:75508390-75508412 ACAGCTGTATCCAGGAGCACAGG + Intergenic
1111091380 13:83452412-83452434 GCAGCTGTTCCCAGGAGCACGGG - Intergenic
1111487885 13:88927294-88927316 GCAGCTGTGCCCAGGAGCACAGG + Intergenic
1114588288 14:23835053-23835075 ACATCAGCTCCCAGGAACTCTGG + Intergenic
1114594997 14:23904288-23904310 ACATCAGCTCCCAGGAACTCTGG - Intergenic
1119544956 14:75464840-75464862 CCATCTGCGGTCAGGAGCAGTGG + Intronic
1121742971 14:96266942-96266964 TCATCTGAGCCCAGGAGGTCAGG + Intronic
1122079388 14:99256556-99256578 ACTTCTGAGCCCAGGAGGCCTGG - Intronic
1122878820 14:104680793-104680815 TCATCAGCGCTCAGGAGCCCGGG + Intergenic
1125861981 15:43008254-43008276 GCAGCTGTGCCCGGGAGCACGGG - Intronic
1126205871 15:46044082-46044104 TCATCTGAGGCCAGGATCACTGG + Intergenic
1128695213 15:69756731-69756753 ACATATGTGCCCAGGAAAACTGG - Intergenic
1129062230 15:72869248-72869270 CCATCTGCTCCCAGGAGGATTGG + Intergenic
1129308172 15:74684120-74684142 TCACCTGAGCCCAGGAGCCCAGG - Intronic
1129455247 15:75673295-75673317 ACATCCCCTCCCAGGAGCTCAGG - Intergenic
1130221305 15:82021856-82021878 ACACCTATGCCCAGGAGAACTGG - Intergenic
1131059470 15:89395723-89395745 ACGTCTGAGCCCAGCTGCACAGG - Intergenic
1133282093 16:4672436-4672458 GCATCTGGGCCCAGGACAACTGG + Intronic
1133757691 16:8774945-8774967 AGTTCTGGGCCCATGAGCACTGG + Exonic
1133923929 16:10179640-10179662 AGAGGTGGGCCCAGGAGCACTGG - Intronic
1137451379 16:48577798-48577820 ATCCCTGCGCCCAGGGGCACTGG - Intronic
1138298008 16:55903213-55903235 ACACCTGCACACAGGTGCACTGG - Intronic
1139664880 16:68448420-68448442 AGATCTGCGGCCGGGAGCCCGGG - Exonic
1142356844 16:89605367-89605389 ACATGCGCGCCCAGGAGCCCTGG - Intergenic
1143540229 17:7564034-7564056 TCATCTGCGCTCAAGACCACGGG - Intronic
1144389875 17:14783939-14783961 GCAGCTGTGCCCAGGAGCATGGG - Intergenic
1146133614 17:30298638-30298660 CCATCTGTGTCCAGGAGAACTGG + Intergenic
1147036261 17:37683756-37683778 ACCTCTGCACCCAGGAGAAGAGG + Intergenic
1147862730 17:43533146-43533168 ACACCTGGGCCCATGAGCAGTGG + Intronic
1147950533 17:44105218-44105240 ACATCTGAGCCCAGGGGTGCAGG + Intronic
1149684266 17:58526495-58526517 ATATCTGCCCCCAAGGGCACTGG - Intronic
1150083721 17:62263030-62263052 ACAGATGCGCACAGGAGCCCCGG - Intergenic
1151965472 17:77429045-77429067 ACATCTGCAACCAGGAGCAGGGG - Intronic
1152020714 17:77778987-77779009 GCAGCTGTGCCCAGGAGCCCTGG + Intergenic
1152208984 17:78992988-78993010 ACATCTGCCCACAGCTGCACAGG - Exonic
1155211723 18:23607827-23607849 ACATCTTCTCCCAGGAGCAGTGG - Intronic
1155819075 18:30352511-30352533 ACAGCTGCGCCCAGGAGTGTGGG - Intergenic
1158774018 18:60555264-60555286 GCAGCTGCACCCAGGAGCGCAGG - Intergenic
1160577372 18:79864269-79864291 ACATCCGCGCCGAGGAGGAGCGG + Exonic
1160885737 19:1346716-1346738 ACCTCTGCCCCCGAGAGCACTGG + Intergenic
1161253652 19:3294683-3294705 ACAGCTGCGTCCCCGAGCACTGG - Intronic
1163567314 19:18059277-18059299 GCATCCACCCCCAGGAGCACTGG - Exonic
1165489028 19:36112781-36112803 ACCTCTGCTCCCAGGGGCCCTGG + Exonic
1166260095 19:41632905-41632927 ACCTGTGCCTCCAGGAGCACTGG + Intronic
1166422543 19:42650277-42650299 ACATCTGCGCCCTGGGGCTCAGG + Intronic
1168094617 19:54107610-54107632 ACATCTGGACCCAGGAACACTGG - Intronic
1168099185 19:54132009-54132031 ACACCTACGCCCAGGTGCCCAGG + Intergenic
1168630326 19:57950936-57950958 GCAGCTGCGCCTGGGAGCACAGG + Intergenic
925131565 2:1497360-1497382 ACACCTGCTCCCAGGTGCCCTGG - Intronic
926526210 2:13984539-13984561 AGATCAGAGCCCAGAAGCACTGG - Intergenic
927236580 2:20880505-20880527 GCAGCTGCGCCCAGGAGCTCAGG + Intergenic
927993555 2:27465623-27465645 TCATCTCCTCCCAGGATCACTGG + Intronic
928171103 2:29003479-29003501 AGATCTGCGCCTGGGAGCAGAGG - Exonic
928470383 2:31569072-31569094 GCAGCTGCGCCAAGGAGCACTGG + Intronic
929771653 2:44897465-44897487 ACATCAGGGCACAGGAGCACAGG - Intergenic
929847257 2:45542414-45542436 GCAACTGCGCCCAGGAGCATGGG + Intronic
930759368 2:55016293-55016315 ACATATGCGGCCAGGTGCGCTGG + Intronic
933454802 2:82507681-82507703 ACAGCTGCACCTGGGAGCACAGG - Intergenic
934057592 2:88265075-88265097 ACATTTGCGGCCAGGTGCAGTGG + Intergenic
934059882 2:88283903-88283925 TCATTTGCCCCCAGGAGCATTGG - Intergenic
934904353 2:98185990-98186012 ACAGCAGCTCCCAGGAGCATGGG - Intronic
935112688 2:100106646-100106668 CCAGCTGCAGCCAGGAGCACGGG - Intronic
935719618 2:105968489-105968511 ACATCAGCCCCAAGGAGGACGGG + Intergenic
937582844 2:123509634-123509656 ACATTTGTGCAAAGGAGCACAGG + Intergenic
937737706 2:125312547-125312569 GCAGCTGAGCCCAGGAGCCCAGG - Intergenic
939488779 2:142851353-142851375 ACATCTCAGCACAGTAGCACAGG + Intergenic
942154198 2:173110336-173110358 ACATCTGAGCCCAGGAGGTCAGG - Intronic
942172013 2:173298219-173298241 ATTTCTGTGCCCAGGGGCACTGG + Intergenic
943396284 2:187338923-187338945 GCAGCTGCGCCCAGGGGCACAGG + Intergenic
946495479 2:220191996-220192018 GCATCTGTGCCCGGGAGCATGGG - Intergenic
947828780 2:233124613-233124635 ACAGCTGCCCCCAGGCGCCCAGG + Intronic
948742519 2:240057103-240057125 AAATCTTCACCCAGGGGCACAGG - Intergenic
948804265 2:240446728-240446750 GCATCTGGGTCCTGGAGCACTGG + Intronic
1169070415 20:2724817-2724839 TCATCTGAGCCCAGGAGCTGGGG + Intronic
1170818931 20:19739619-19739641 ACATCAGCTCCAAGGAGGACCGG + Intergenic
1171869108 20:30511919-30511941 ACATCAGCGCCCTGGAGCCTTGG - Intergenic
1172084512 20:32370004-32370026 ACATCTGTGGCCAGGTGCAGTGG - Intronic
1173945111 20:46944230-46944252 GGATCTGCGCACGGGAGCACTGG - Intronic
1174236910 20:49101604-49101626 TCATCTGCCCCCTGGAACACTGG - Intergenic
1175312971 20:58024577-58024599 GCAGCTGCGCCCAGGAGGGCAGG + Intergenic
1175803411 20:61813890-61813912 TCAGCTGCTCCCAGGGGCACTGG - Intronic
1175912771 20:62412673-62412695 GCATCTGCACCCAGGAGCACGGG - Exonic
1176301725 21:5101843-5101865 AGCTCTGTGCCCAGGAGCAGTGG - Intergenic
1176365561 21:6030584-6030606 GCATCTGCGACCAGGAACTCGGG + Intergenic
1179554026 21:42160956-42160978 ACATCTCCGCTCAGGAGCCTTGG + Intergenic
1179757957 21:43507961-43507983 GCATCTGCGACCAGGAACTCGGG - Intergenic
1179855306 21:44160056-44160078 AGCTCTGTGCCCAGGAGCAGTGG + Intergenic
1180155439 21:45975120-45975142 ACAGCTGCGCCCACGGGCAGGGG - Intergenic
1180967948 22:19800291-19800313 ACCTCTGTGCCCAGGACCCCAGG - Intronic
1182022176 22:27090505-27090527 CCAGCTGCTCTCAGGAGCACAGG + Intergenic
1182257489 22:29049473-29049495 ACCGCTGCGGCCTGGAGCACCGG + Exonic
1183316719 22:37141155-37141177 GCAGCTGCGCCCAGGAGAGCGGG - Intronic
1184158845 22:42686284-42686306 ACAGCTGGGCCTAGGAGCAGGGG - Intergenic
1184762420 22:46552031-46552053 AGAGCTGAGCCCAGGAGCTCTGG - Intergenic
949435059 3:4020207-4020229 ACATATCCGGCCAGGAGCAGTGG + Intronic
950038161 3:9902205-9902227 ACAGCTGAGCCCTGGAGCAGAGG - Intergenic
951464826 3:22990448-22990470 AGATCCGCGCCCAGGCGCACTGG + Intergenic
954099447 3:48358063-48358085 ACAGCTGCACCCAGGAGAGCAGG + Intergenic
954144453 3:48627557-48627579 TCATTTGAGCCCAGGAGCTCGGG - Intronic
954964029 3:54594799-54594821 ACATCTGGGCCCAGGACCCCAGG - Intronic
957804384 3:85128240-85128262 TCAGCTGCGCCCAGGAACATGGG + Intronic
960087515 3:113606900-113606922 CCATCTGTGCAGAGGAGCACTGG + Intronic
960964051 3:123092307-123092329 ACATCTGTGACCAAGGGCACTGG - Intronic
961107846 3:124257568-124257590 ACTTCTGGGCCCAAGAGCCCTGG + Intronic
961311277 3:126003706-126003728 GCAGCTGTGCCCAGGAGCGCAGG - Intergenic
961493517 3:127274158-127274180 GCAGCTGCGCCCAGGAGGACAGG - Intergenic
962315588 3:134357553-134357575 CCATCTGGTCCCAGGAGCTCAGG - Exonic
963252916 3:143119317-143119339 ACCTCTGCGCCCTGGAGCGGTGG - Exonic
963346177 3:144098903-144098925 GCAGCTGCTCCCAGGAGCACTGG - Intergenic
964904133 3:161697213-161697235 ACATTTGAGCACAGCAGCACAGG - Intergenic
967284515 3:187855243-187855265 ACATCTGCCTCCAGGAACAGAGG + Intergenic
969179126 4:5423926-5423948 ACAGCTGCACCCAGGAGGGCAGG - Intronic
969474344 4:7412756-7412778 ACAGCTGAGCCCAGGGGGACAGG - Intronic
969668869 4:8578623-8578645 AGATCTGAGGCCAGAAGCACTGG + Intronic
970447587 4:16136954-16136976 CCATCTGCTGCCAGGAGCCCTGG + Intergenic
971238875 4:24869363-24869385 ACAGCAGGGCCCAGGAGCCCAGG - Intronic
971834750 4:31748526-31748548 GCAGCTGCGCCTAAGAGCACAGG + Intergenic
971867246 4:32189285-32189307 GCAGCTGTGCCCAGGAGCACCGG - Intergenic
972075159 4:35078797-35078819 GCAGCTGTGCCTAGGAGCACGGG - Intergenic
972365181 4:38367853-38367875 ACATCTGTCCCCTGGATCACAGG - Intergenic
974823328 4:67096006-67096028 AAATCTGAGTCCAGGAGCAGTGG - Intergenic
978061349 4:104344513-104344535 GCAGCTGCACCCAGGAGCATGGG - Intergenic
978347750 4:107789045-107789067 GCAGCTGTGCCCAGGAGCACAGG + Intergenic
980187611 4:129481816-129481838 ACAGCTCCGCCCAGGTGCAGTGG - Intergenic
982480352 4:155901448-155901470 AAATCTGAGCCTAGGAGCAGTGG + Intronic
983508887 4:168586661-168586683 AGCTCTGCCACCAGGAGCACTGG - Intronic
986923445 5:12717020-12717042 GCAGCAGTGCCCAGGAGCACAGG - Intergenic
987726915 5:21715175-21715197 CCATCTATGCCCAGGAGTACTGG - Intergenic
987816095 5:22902168-22902190 GCAGCTGCGCCCAGGAGCAGGGG + Intergenic
991039770 5:62163039-62163061 TCTGCTGCACCCAGGAGCACAGG + Intergenic
992520546 5:77545972-77545994 ATCCCTGTGCCCAGGAGCACTGG + Intronic
994451477 5:99950172-99950194 GCAGCTGCGCCCAGGAGCGCAGG - Intergenic
994753333 5:103764809-103764831 GCAGCTGCGCCCAGGAGCATGGG + Intergenic
995732893 5:115264922-115264944 ATCCCTGCGCCCAGGAGCACTGG - Intergenic
995926922 5:117385975-117385997 GCAGCTGCACCCAGGAGCATAGG - Intergenic
996366327 5:122705146-122705168 ACATGAGCTCCCAGGAGGACTGG + Intergenic
998762365 5:145446757-145446779 AAATCTGAGGCCAGGAGCAGTGG + Intergenic
1000854350 5:166379836-166379858 GCAGCTGCGCCCAGGAGGACGGG + Intergenic
1004297512 6:14426983-14427005 ACAGCAAAGCCCAGGAGCACAGG - Intergenic
1004918117 6:20351082-20351104 ACATCTCTGGCCAGGAGCAGTGG + Intergenic
1005781824 6:29201112-29201134 GCAGCTGCGCCCAGGAGGGCAGG - Intergenic
1005879488 6:30044573-30044595 ACATCTGTGCCCAGCATCAGGGG - Intergenic
1007214685 6:40228022-40228044 GCAGCTGCGCCCAGGAGTGCAGG - Intergenic
1009307088 6:62103607-62103629 GCAGCTGCGCCCAGGAGCGCAGG + Intronic
1010489245 6:76453565-76453587 GCAGCTGTGCCCAGTAGCACAGG + Intergenic
1011284281 6:85706683-85706705 ACAGCTGCACCCAGGAGCGAGGG + Intergenic
1011347917 6:86392027-86392049 ACATCATGGCCCATGAGCACAGG + Intergenic
1012133065 6:95520013-95520035 GCAGCTGCGCCCAGGAGGGCGGG + Intergenic
1015440262 6:133240636-133240658 ATACCTGCACCCAGCAGCACTGG + Intronic
1017545382 6:155445440-155445462 AAATCTGCTCCTAGGACCACAGG - Intronic
1017977803 6:159373594-159373616 ACCTCTGGTCCCAGGAGCACAGG + Intergenic
1019386166 7:757369-757391 ACATCTACCCCCAGCAGCATGGG - Intronic
1019540589 7:1549503-1549525 GCATCTGCGCCGAGGACCCCAGG - Intronic
1024233160 7:47378100-47378122 ATATCAGCTCCCAGGACCACTGG + Intronic
1026104902 7:67413146-67413168 ACATCTGCACCCAGGTGTTCAGG - Intergenic
1026588452 7:71676906-71676928 ACTTCTGCATACAGGAGCACTGG - Intronic
1027682104 7:81233692-81233714 GCATTTGCACCCAGGAGCACAGG + Intergenic
1028402048 7:90434344-90434366 ACAGCTGCACCCAGGAGCATGGG + Intronic
1029122696 7:98279368-98279390 ACAGCTGCCCCCAGGAACAATGG + Intronic
1030721838 7:112880988-112881010 ACAGCTGCGCCCAGGAGGGTGGG - Intronic
1030757564 7:113307368-113307390 ACATCTGAGCCAAGGAGTAGAGG + Intergenic
1031858996 7:126957411-126957433 GCAGCTGCGCCCAGAAGCATGGG - Intronic
1035390105 7:158497891-158497913 ACATCTGTGCCCGGCAGAACAGG - Intronic
1035412535 7:158656608-158656630 CCACCTGCCCCCAGGAGCAGAGG + Exonic
1037405007 8:18532953-18532975 ACCTCAGCGCCCAGGAGCCTTGG - Exonic
1038575205 8:28699081-28699103 ACATCTGAGCCCAGGGACATCGG + Intronic
1042624990 8:70748257-70748279 ACATCTGCGCCCAGGAGCACAGG - Intronic
1047544051 8:125797962-125797984 GCAGCTGTGCCCAGGAGCATGGG + Intergenic
1048347659 8:133589225-133589247 ACATATGTGCCGAGGAGTACTGG + Intergenic
1049007529 8:139865020-139865042 ACATCTGCACTCATTAGCACCGG + Intronic
1053136059 9:35650783-35650805 ACATCTGCAGCCATGAGCAGAGG - Exonic
1053202962 9:36165197-36165219 ACATCTTCACCCGGGAGCAGGGG - Intergenic
1056949265 9:91029034-91029056 ACATCTACCCTCAGGACCACAGG - Intergenic
1058140964 9:101356672-101356694 TCAGCTGCCTCCAGGAGCACCGG + Intergenic
1059421529 9:114195479-114195501 AGATCGGCACCCAGGAGCCCAGG + Intronic
1059932305 9:119273023-119273045 ACATCAGGGCCCAGAAGCCCTGG - Intronic
1060618728 9:125043911-125043933 GCAGCTGCACCCAGGAGCGCTGG - Intronic
1061303486 9:129719524-129719546 GCATCTGAGGCCAGGAGGACGGG + Intronic
1061385478 9:130286962-130286984 CCGTCCGCTCCCAGGAGCACAGG + Intronic
1061544760 9:131298339-131298361 ACTTCCCAGCCCAGGAGCACTGG + Intronic
1062712226 9:137982277-137982299 ACATCTGCTTCCAGGCTCACTGG + Intronic
1185779215 X:2830130-2830152 AGACCTGCGCCCGGGAGCAGTGG - Exonic
1188500072 X:30815670-30815692 ACATCTGGGGCCAGGCGCAGTGG - Intergenic
1188727883 X:33607453-33607475 ACAGCTGCACCCAGGAGTGCAGG + Intergenic
1190998686 X:55637108-55637130 ACAGCTGCACCCAGGAGGGCAGG - Intergenic
1192149832 X:68705392-68705414 ACAGCTGCACACAGGAGCTCAGG + Intronic
1192174626 X:68878063-68878085 CCATCTGTGCCCTGGTGCACCGG - Intergenic
1195830323 X:109050614-109050636 ATATCTGGGGCCAGGAGCAATGG + Intergenic
1198530762 X:137548373-137548395 ACCCCTGCGCACAGGACCACCGG - Intergenic
1199559375 X:149146854-149146876 ACAGCTGCACCCGGGAGCAGGGG - Intergenic
1200686873 Y:6265778-6265800 TCAACTGCGCACAGGAGCTCGGG + Intergenic
1200690878 Y:6305846-6305868 TCAACTGCGCACAGGAGCTCAGG - Intergenic
1200989750 Y:9336694-9336716 TCAACTGCGCACAGGAGCTCGGG + Intergenic
1200992418 Y:9357027-9357049 TCAACTGCGCACAGGAGCTCGGG + Intergenic
1200995070 Y:9377305-9377327 TCAACTGCGCACAGGAGCTCGGG + Intronic
1200997735 Y:9397651-9397673 TCAACTGCGCACAGGAGCTCGGG + Intergenic
1201000245 Y:9466185-9466207 TCAACTGCGCACAGGAGCTCGGG + Intergenic
1201002906 Y:9486497-9486519 TCAACTGCGCACAGGAGCTCGGG + Intronic
1201005564 Y:9506780-9506802 CCAACTGCGCACAGGAGCTCGGG + Intergenic
1201008225 Y:9527110-9527132 TCAACTGCGCACAGGAGCTCGGG + Intergenic
1201044394 Y:9868870-9868892 TCAACTGCGCACAGGAGCTCAGG + Intergenic
1201290833 Y:12420359-12420381 AGACCTGCGCCCAGGCGCAGTGG + Intergenic
1201337888 Y:12899996-12900018 TCATCTGAGCCCAGGAGATCAGG + Intergenic
1202073591 Y:21016830-21016852 GCAGCTGTGCCCAGGAGCATGGG + Intergenic
1202078291 Y:21058684-21058706 GCAGCTGTGCCCAGGAGCATGGG + Intergenic
1202115648 Y:21467359-21467381 TCAACTGCGCACAGGAGCTCGGG + Intergenic