ID: 1042624991

View in Genome Browser
Species Human (GRCh38)
Location 8:70748265-70748287
Sequence GGGCAGCTACATCTGCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 14, 3: 101, 4: 361}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042624991_1042624995 -2 Left 1042624991 8:70748265-70748287 CCTGGGCGCAGATGTAGCTGCCC 0: 1
1: 0
2: 14
3: 101
4: 361
Right 1042624995 8:70748286-70748308 CCAGCTGCAGCTCTAGACCTGGG No data
1042624991_1042624997 16 Left 1042624991 8:70748265-70748287 CCTGGGCGCAGATGTAGCTGCCC 0: 1
1: 0
2: 14
3: 101
4: 361
Right 1042624997 8:70748304-70748326 CTGGGCATCCCTGCACTCGCAGG No data
1042624991_1042624999 18 Left 1042624991 8:70748265-70748287 CCTGGGCGCAGATGTAGCTGCCC 0: 1
1: 0
2: 14
3: 101
4: 361
Right 1042624999 8:70748306-70748328 GGGCATCCCTGCACTCGCAGGGG No data
1042624991_1042625001 24 Left 1042624991 8:70748265-70748287 CCTGGGCGCAGATGTAGCTGCCC 0: 1
1: 0
2: 14
3: 101
4: 361
Right 1042625001 8:70748312-70748334 CCCTGCACTCGCAGGGGCCCAGG No data
1042624991_1042624993 -3 Left 1042624991 8:70748265-70748287 CCTGGGCGCAGATGTAGCTGCCC 0: 1
1: 0
2: 14
3: 101
4: 361
Right 1042624993 8:70748285-70748307 CCCAGCTGCAGCTCTAGACCTGG No data
1042624991_1042624998 17 Left 1042624991 8:70748265-70748287 CCTGGGCGCAGATGTAGCTGCCC 0: 1
1: 0
2: 14
3: 101
4: 361
Right 1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042624991 Original CRISPR GGGCAGCTACATCTGCGCCC AGG (reversed) Intronic
900104479 1:976467-976489 GCGCAGCTCCCTCTGCCCCCAGG + Intronic
900233888 1:1577418-1577440 GGGCAGATGCAGCTGCTCCCAGG - Intergenic
900953499 1:5873066-5873088 GGGCAGCTCCGTCTGGGCGCTGG - Intronic
901936496 1:12630530-12630552 GGGTAGCTGCACCTGCACCCAGG - Intergenic
902776712 1:18679463-18679485 GGGCAGCTTCATCTGGCCACTGG + Intronic
903750276 1:25617034-25617056 GGGCGGCTGCAGATGCGCCCGGG - Intergenic
905545936 1:38800887-38800909 GGGCAGCTGCAGCTGTGCCCAGG - Intergenic
905545957 1:38800980-38801002 GGGCAGCTACAGCTGCGCTTGGG - Intergenic
907761707 1:57367922-57367944 GGGCGGCTGCAGCTGCACCCAGG - Intronic
909238467 1:73181497-73181519 GGGCAGCTACAGCAGCACCCAGG + Intergenic
910259736 1:85283767-85283789 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
910602260 1:89044101-89044123 GGGCAGCTGCAGCTGCGCCCAGG + Intergenic
911288772 1:96029197-96029219 GGGCGGCTGCAGCTGTGCCCAGG + Intergenic
912013847 1:105006071-105006093 GGGCAGCTGCAGCTACACCCAGG + Intergenic
912093657 1:106113751-106113773 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
913103787 1:115594045-115594067 GGGCAGCTGCTGCTGAGCCCAGG + Intergenic
914392839 1:147237318-147237340 GAGCAGCTATAGCTGCACCCAGG + Intronic
915185226 1:154099285-154099307 GGGCAGCCAAAGCTGCACCCAGG + Intronic
916966247 1:169945367-169945389 GGGCGGCTGCAGCTGTGCCCAGG + Intronic
917326589 1:173839093-173839115 GCGAAGCTACATCTGATCCCAGG - Intronic
918993955 1:191732176-191732198 AGGCAGCTCCACCTGCGGCCCGG + Intergenic
919083326 1:192891773-192891795 GGGCAGCTGTAGCTGCGCCCAGG + Intergenic
919249260 1:195031021-195031043 GGGCAGCTGTAGCTGTGCCCAGG + Intergenic
919263909 1:195237393-195237415 GGGTGGCTACAGCTGCCCCCAGG - Intergenic
919314065 1:195948640-195948662 GGGCAGCCACAGCTGCACCCAGG + Intergenic
919453888 1:197801013-197801035 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
920269413 1:204752078-204752100 GGGCGGCTACAGCAGCACCCAGG - Intergenic
920998182 1:211015138-211015160 GGGCAGCTACATTTTCCCCAAGG - Intronic
922025185 1:221742883-221742905 GGGCAGCGACATCTGCGGGCGGG - Intergenic
923918073 1:238530670-238530692 GGGAAGCTGCACCTGCGCCCAGG + Intergenic
924679828 1:246220431-246220453 GGTCAGCTGCAGCTGTGCCCAGG - Intronic
1062770140 10:92549-92571 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1062771595 10:105324-105346 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
1063389808 10:5641845-5641867 TGGCGGCAACATCTACGCCCGGG - Exonic
1065806017 10:29394478-29394500 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1065981501 10:30902765-30902787 AGGCAGCTCCACCTGCGGCCCGG - Intronic
1066101630 10:32122969-32122991 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1067258802 10:44667700-44667722 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
1068283779 10:54909645-54909667 GGGCAGCTGCAGCTGTGCCTAGG + Intronic
1068919150 10:62465008-62465030 GGGCAGCTGCATCTGCACCCGGG - Intronic
1069090737 10:64196727-64196749 GGGCAGCTCCACCTGCGGCCCGG - Intergenic
1069121699 10:64576503-64576525 GGGCAGCTGCAGCTGCACCAGGG - Intergenic
1069249193 10:66246298-66246320 GGGCAGCCACAACTGCGCCCAGG + Intronic
1069561889 10:69436325-69436347 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1072154810 10:92714863-92714885 GGGCAGCTGCAGCTGCACTCTGG + Intergenic
1072753183 10:97999140-97999162 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1074028662 10:109663296-109663318 GGGCGGCTGCAGCTGCACCCAGG - Intergenic
1074028682 10:109663377-109663399 GGGCAGCTTCAGCTGCACCCGGG - Intergenic
1075007675 10:118842385-118842407 GGGCGGCTGCAGCTGCACCCGGG - Intergenic
1075196189 10:120361293-120361315 GGGCAACTGCATCTGCACCCAGG - Intergenic
1076687489 10:132204635-132204657 GGGCAGCCTCACCTGCACCCCGG + Intronic
1076859523 10:133134021-133134043 GGGCAGCCACGTCTGTGCTCAGG - Intergenic
1077107631 11:848907-848929 GTGCAGGCACATCTGCGCACGGG + Intronic
1077140296 11:1021257-1021279 AGGCTGCTACAACTGCTCCCAGG - Exonic
1077507893 11:2940614-2940636 GGGCAGCTACAGCTGTGTCCAGG - Intergenic
1077514728 11:2994547-2994569 GGGCAGCTGGACCTGCTCCCTGG + Intergenic
1077815673 11:5683313-5683335 AGGCAGCTCCACCTGCGGCCCGG + Intronic
1077844802 11:6013061-6013083 GGGTGGCTGCATCTGTGCCCAGG + Intergenic
1078089593 11:8256513-8256535 GGGCAGCTGCCTCTGCGACCTGG + Intronic
1078345644 11:10545203-10545225 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
1079673933 11:23202172-23202194 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
1079756739 11:24274238-24274260 AGGCAGCTCCACCTGCGGCCTGG - Intergenic
1080706608 11:34701359-34701381 GGGCAGCTACAGCTGCACCTGGG - Intergenic
1080874890 11:36266222-36266244 GGCAAGCTCCAGCTGCGCCCAGG + Intergenic
1081617687 11:44600281-44600303 GAGCAGCTGTATCTGCGCCCTGG - Intronic
1081627962 11:44666695-44666717 GGGCAGCCACCTCTGGCCCCTGG + Intergenic
1081953074 11:47062908-47062930 GAGCAGCTGCATCTCTGCCCTGG - Intronic
1085496757 11:76977766-76977788 GGGCATCTGCAGCTGTGCCCGGG - Intronic
1086085220 11:82946193-82946215 GGGCAACTGCAGCTGCACCCTGG + Intronic
1086087642 11:82971083-82971105 AGGCAGCTCCACCTGCGCCCCGG + Intergenic
1088704353 11:112448150-112448172 AGGCAGCTGCAGCTGCACCCAGG + Intergenic
1089591774 11:119546458-119546480 GGGCAGCTGCAGCTGCACCTGGG - Intergenic
1089666937 11:120026305-120026327 AGGCAGCTCCACCTGCGGCCCGG + Intergenic
1089822647 11:121241878-121241900 GGGCAGCTGCAGCTGCACCCAGG + Intergenic
1089823055 11:121246227-121246249 AGGCAGCTACAGCTGCACCCGGG - Intergenic
1092447226 12:8568461-8568483 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
1093281678 12:17203655-17203677 GGGCAGCAGCAACTGTGCCCGGG - Intergenic
1094427232 12:30328161-30328183 GAGCAGCTGCAGCTGCACCCAGG - Intergenic
1094722117 12:33075709-33075731 AGGCAGCTCCACCTGCGGCCGGG + Intergenic
1096355648 12:50938478-50938500 GGCCAGCTGCAGCTGTGCCCAGG + Intergenic
1096773909 12:53952703-53952725 GGGCAGCTAGGTCTGCGCCCAGG - Intergenic
1098290956 12:68956348-68956370 GGGCAGCTGCAGCTGCACCCAGG + Intronic
1099574438 12:84362304-84362326 GGGTGGCTACAGCTGTGCCCAGG - Intergenic
1100607795 12:96165991-96166013 TGGCAGCTTCTTCTGAGCCCTGG - Intergenic
1100847768 12:98678516-98678538 GGGCGGCTACAGCTACACCCAGG - Intronic
1100847788 12:98678595-98678617 GGGCAGCTACAGCTGCACCAGGG - Intronic
1101764060 12:107682488-107682510 GGGCAGCCACAGCTGCACCCTGG + Intergenic
1102060325 12:109926534-109926556 GGGCAGCCACAGCTGCACCCGGG - Intronic
1102261190 12:111444554-111444576 GGCCAGCAACAGCTGCTCCCTGG - Intronic
1102695961 12:114799723-114799745 GGGCAGCTTCATCTCCCCGCTGG - Intergenic
1104742412 12:131188355-131188377 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1104805450 12:131586608-131586630 GGACAGCTGCAGCTGCACCCAGG - Intergenic
1105954601 13:25268813-25268835 GGGCGGCTGCAGCTGTGCCCGGG - Intronic
1106379433 13:29222688-29222710 GGGCAGCTGCAGCTGCACCCAGG - Intronic
1106571923 13:30934988-30935010 GGGCAGCTGCAGCTGCACCAGGG - Intronic
1106620196 13:31365051-31365073 GGACAGCCACAGCTGCACCCGGG - Intergenic
1106979230 13:35256911-35256933 GGGCAGCTGCAGTTGCACCCGGG + Intronic
1107234831 13:38155589-38155611 GGGCAGCTGCAACTGCTCCTGGG + Intergenic
1107446002 13:40471016-40471038 GGGCAGCTACATCTTGGCTTTGG - Intergenic
1107841023 13:44458577-44458599 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1108017104 13:46087069-46087091 GGGCAGCTGCAGCTGCGCCCAGG + Intronic
1108017126 13:46087158-46087180 GGGCAGCTGCAGCTGCGCCTGGG + Intronic
1109030082 13:57179805-57179827 GGGCAGCTGCAACTGCACCTGGG + Intergenic
1109348367 13:61145078-61145100 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1109396624 13:61766783-61766805 GGACGGCTGCAGCTGCGCCCAGG + Intergenic
1109686558 13:65829406-65829428 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
1109837359 13:67877368-67877390 GGGCAGCTGCAGCTGTGCCCAGG - Intergenic
1109982194 13:69923836-69923858 GGGCAGCTGCAGCTGCGCCTGGG - Intronic
1110008117 13:70297413-70297435 GGGCAGCTGCAACTGCACCTGGG - Intergenic
1111002553 13:82205083-82205105 GGGTGGCTACAGCTGTGCCCAGG - Intergenic
1111337348 13:86840672-86840694 GGGTGGCTACAGCTGCACCCAGG + Intergenic
1112201956 13:97285194-97285216 GGGAATCTGCATCTGAGCCCTGG + Intronic
1112282629 13:98076290-98076312 AGGCAGCTCCACCTGCGGCCCGG - Intergenic
1112505285 13:99971255-99971277 GGGCAGCTACCCCTGCGGCGGGG - Exonic
1114192990 14:20454773-20454795 GGCCAGCTTCCTCTGCGCTCCGG - Exonic
1114344427 14:21780699-21780721 GGGCAGCTGCAGTTGCACCCAGG - Intergenic
1114559792 14:23581164-23581186 AGGCAGCTCCACCTGCGGCCTGG + Intergenic
1114643888 14:24242728-24242750 GGGCAGCTACAGCTCCGCTGGGG - Intergenic
1115118363 14:29909417-29909439 AGGCAGCTCCACCTGCGGCCTGG + Intronic
1115310689 14:31975118-31975140 GGGCAGCTGCAGCTGCACCCGGG + Intergenic
1116356650 14:43938787-43938809 GGGCAGCTGCAGCTGTGCCGGGG - Intergenic
1116390596 14:44385148-44385170 AGGCAGCTCCACCTGCGCCCCGG + Intergenic
1116653834 14:47626911-47626933 AGGCAGCTCCACCTGCACCCCGG + Intronic
1118213679 14:63788423-63788445 AGGCAGCTGCAGCTGCACCCGGG + Intergenic
1118522113 14:66596774-66596796 TGACGGCTACAACTGCGCCCGGG + Intronic
1120229691 14:81829419-81829441 GGGCAGCTCCACCTGCAGCCAGG - Intergenic
1120745425 14:88147177-88147199 GGGCAGCTGCAGCTACACCCAGG - Intergenic
1121973960 14:98385504-98385526 GGGCAGTTGCAGCTGCACCCAGG - Intergenic
1122788268 14:104173818-104173840 GGGCAGCGTCATCTTGGCCCTGG + Exonic
1123038151 14:105479605-105479627 GGGCAGCTACATCTATGACCGGG + Exonic
1123222907 14:106873085-106873107 GGGAGGCTGCATCTGAGCCCAGG - Intergenic
1202940704 14_KI270725v1_random:143187-143209 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
1124387784 15:29224748-29224770 AGGCAGCTCCACCTGCGGCCCGG - Intronic
1124820743 15:33043888-33043910 GGGCAGCTGCAGCTGCACCCAGG - Intronic
1124963388 15:34414870-34414892 GGGCAGCTGCCTCTGCTGCCTGG + Intronic
1124980009 15:34561096-34561118 GGGCAGCTGCCTCTGCTGCCTGG + Intronic
1125631662 15:41152045-41152067 AGGCAGCTCCACCTGCGCCCCGG + Intergenic
1125861983 15:43008262-43008284 GGGCAGTTGCAGCTGTGCCCGGG - Intronic
1126292761 15:47100060-47100082 GGGCAGCTGCAGCGGCACCCAGG + Intergenic
1128594035 15:68928909-68928931 AGGCAGCTCCACCTGCGCCTGGG - Intronic
1129799870 15:78405799-78405821 GGGCGGCTGCAGCTGCACCCAGG - Intergenic
1131094961 15:89649029-89649051 GGGCAACGTCATCAGCGCCCTGG - Exonic
1132745100 16:1433213-1433235 GGGCAGCTTCCTCTGGGCCATGG - Intergenic
1132837066 16:1959503-1959525 GGGCGGCTGCGTCTGCGCGCTGG - Exonic
1133111317 16:3549816-3549838 GGGCAGCTCCCTCTGGGTCCTGG - Intronic
1137256306 16:46778150-46778172 GGGCAGCCACAGCTGCACCCTGG - Intronic
1137291675 16:47055759-47055781 GGGCAGCTGCAGCGGCACCCAGG + Intergenic
1137334451 16:47533874-47533896 GGGCAGCTGCAGCTGCACCAGGG + Intronic
1137334472 16:47533955-47533977 GGGCGGCTGCAGCTGCACCCAGG + Intronic
1138878236 16:60979211-60979233 GGGCAGCTGCAGCTGCACCTTGG - Intergenic
1139150862 16:64380952-64380974 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1140103386 16:71938073-71938095 GGGCAGCTGCAGCTCTGCCCAGG - Intronic
1141141510 16:81499668-81499690 GGGGAGCCACCTCTGCTCCCCGG - Intronic
1141998358 16:87648903-87648925 GGCCAGCAGCATCTGCGTCCTGG - Intronic
1142940788 17:3378516-3378538 GGGCAGCTGCAGCTGCGCCTAGG + Intergenic
1143392436 17:6567709-6567731 AGGCAGCTGCCTCTGGGCCCTGG - Intergenic
1143552796 17:7641242-7641264 AGGCAGCTCCACCTGCGGCCTGG + Intergenic
1143592604 17:7894579-7894601 GGGCAGCTCCATTTGCCCTCTGG - Exonic
1145217187 17:21061249-21061271 GGGCAGCTGCAGCTGCCCCCAGG + Intergenic
1145368504 17:22286753-22286775 GGGCAGCTGCAGTTGCGCCTGGG - Intergenic
1146359057 17:32159466-32159488 GGGCAGCTGCAGCTGCGACTGGG - Intronic
1146425176 17:32731750-32731772 GGGCGGCCACAGCTGCACCCAGG - Intronic
1150950814 17:69801084-69801106 GGGCAACTGCAGCTGTGCCCAGG - Intergenic
1151395448 17:73819893-73819915 GGGCAGCTACAGCCCTGCCCAGG + Intergenic
1152608313 17:81303798-81303820 GGCCACCCACATCTGCTCCCCGG + Intergenic
1152636679 17:81433048-81433070 GGCCAGCTCCATCTGTTCCCAGG - Intronic
1152864273 17:82712929-82712951 GGGAAGCTGCACCTGCACCCAGG + Intergenic
1152920520 17:83064304-83064326 GGGCAGCTGCCTCTGCAGCCAGG + Intergenic
1153139485 18:1954958-1954980 GGGCGGCTGTATCTGCACCCAGG + Intergenic
1153608051 18:6854732-6854754 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1154500917 18:14997598-14997620 GGGCAGCTACATACGCGAGCTGG - Intergenic
1154507861 18:15060575-15060597 GGGCAGCTGCAGCAGCACCCGGG - Intergenic
1154507881 18:15060656-15060678 GGGCAGCTGCAGCTGCACCCGGG - Intergenic
1155819077 18:30352519-30352541 GGTCAGCTACAGCTGCGCCCAGG - Intergenic
1155830951 18:30514145-30514167 GGGCAGCTGCAGCTGCACACAGG + Intergenic
1159186609 18:64983747-64983769 GGGCAGCTGCAGCTGCGCCCAGG - Intergenic
1159623743 18:70669063-70669085 GGGCAGCTGCAGATGCACCCAGG - Intergenic
1160216086 18:76932890-76932912 GGGCAGCTAGAGCAGAGCCCTGG - Intronic
1160566351 18:79788671-79788693 GGGCAGACCCACCTGCGCCCTGG - Intergenic
1160806701 19:995142-995164 GGGCGGCTCCAGCTGGGCCCTGG - Intronic
1161166516 19:2790768-2790790 GGGCAGCGCCACCTGCTCCCAGG + Intronic
1161173323 19:2824286-2824308 TGGCAGCTTCAGCTGCACCCAGG + Intronic
1162029266 19:7910304-7910326 GGGCAGCGGCACCTGCGGCCAGG + Exonic
1163023575 19:14496373-14496395 GGGGAGCTGCAGCTGGGCCCCGG + Intergenic
1164984340 19:32637669-32637691 GGGCGGCTGCAGCTGCGCCTGGG - Intronic
1165022445 19:32935778-32935800 GGGCAGCTGCAGCAGCACCCAGG - Intronic
1165027038 19:32969659-32969681 GGGCAGCCACAGCTGCACCTGGG + Intronic
1165152314 19:33768036-33768058 GGACAGCTCCATCAGCGCTCAGG - Intronic
1165943064 19:39424940-39424962 GGGCAGCTGCATTGGGGCCCAGG - Exonic
1166173916 19:41052147-41052169 GGGGAAATACATCTGTGCCCTGG + Intergenic
1166327908 19:42062494-42062516 GGCCAGCCTCATCTGCGCCAAGG - Exonic
1166897346 19:46032378-46032400 GGGCAGCTACAGCTGTGCCCAGG - Intergenic
1167013051 19:46821663-46821685 GGGCAGCTGCAGCTGCACCCGGG - Intergenic
1167234967 19:48308861-48308883 GGGCAGCTGCAGCTGCACCCGGG - Intronic
1167748899 19:51368290-51368312 GGACAGCTGCAACTGAGCCCGGG + Intronic
1168325429 19:55536475-55536497 GGGCAGGGACATCTGTGACCTGG - Intronic
925515180 2:4674200-4674222 TGGCAGCTGCAGCTGCACCCAGG - Intergenic
927236579 2:20880497-20880519 GGGCGGCTGCAGCTGCGCCCAGG + Intergenic
927533998 2:23837481-23837503 GGGCGGCTGCAGCTGCACCCAGG + Intronic
927613669 2:24566960-24566982 GGGCAGTTGCAGCTGCACCCAGG + Intronic
927937425 2:27083581-27083603 GGTCAGCCAGATCAGCGCCCTGG - Exonic
928840391 2:35598706-35598728 GGGCAGCTACAGCTGTGCCTGGG - Intergenic
929847255 2:45542406-45542428 GGGCAGCTGCAACTGCGCCCAGG + Intronic
930800448 2:55438060-55438082 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
930957135 2:57216943-57216965 GGGCAGCTACAGCTGCACCTGGG - Intergenic
931499935 2:62854986-62855008 GGGCAGCTGAAGCTGCACCCAGG - Intronic
931734045 2:65177955-65177977 GGGCAGCTGCAGCTGTGCCCCGG + Intergenic
931762539 2:65431063-65431085 AGGCAGCTGCACCTCCGCCCCGG + Intronic
932644751 2:73488509-73488531 GGGCAGCTGCAGCTGTGCCCAGG + Intronic
933219345 2:79670125-79670147 GGGCAGCCACAGCTGCACCCGGG + Intronic
933454803 2:82507689-82507711 GGGCAGCTACAGCTGCACCTGGG - Intergenic
933801263 2:85961839-85961861 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
934696637 2:96404971-96404993 GGGCAGCTGCACCTGCACCCAGG + Intergenic
935790389 2:106584819-106584841 GGGCAGCTCCACCTGCACCTGGG + Intergenic
936595923 2:113847812-113847834 GGGCAGCCATATTTGCCCCCAGG + Intergenic
937094017 2:119224175-119224197 GGGCGCCCACATCTGCACCCGGG - Intronic
937219128 2:120331546-120331568 GGGCAGCTAGCTCTGCCCCTGGG - Intergenic
938096549 2:128467649-128467671 GGGCAGCTGTAGCTGCACCCGGG + Intergenic
938500088 2:131827788-131827810 GGGCAGCTACATACGCGAGCTGG - Intergenic
939801766 2:146720247-146720269 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
940422930 2:153499896-153499918 GGGCAGCTGCAGCTGAACCCAGG + Intergenic
940423887 2:153509260-153509282 GGGCAGCTGCAGCTGCGTCAGGG + Intergenic
940582725 2:155601444-155601466 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
941440466 2:165528994-165529016 GGGCAGCTGCAACTGCACCCAGG - Intronic
941929320 2:170924633-170924655 GGGCAGCTGCAGCTGCACCCAGG + Intergenic
942103909 2:172613969-172613991 CGGCAGCTGCAGCTGCACCCAGG - Intergenic
943226416 2:185184953-185184975 GGGCAGCTGAAGCTGTGCCCAGG - Intergenic
943396281 2:187338915-187338937 GGGCAGCTGCAGCTGCGCCCAGG + Intergenic
943820477 2:192315004-192315026 GGGCAGCTGCAGCTACGCCCAGG + Intergenic
944055244 2:195516033-195516055 AGGCAGCTCCACCTGCGGCCTGG + Intergenic
944228508 2:197370973-197370995 AGGCAGCTCCACCTGCGGCCCGG + Intergenic
944483715 2:200182040-200182062 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
944587606 2:201186328-201186350 GGGAAGCCACCTCTGGGCCCAGG - Intronic
944843075 2:203642820-203642842 AGGCAGCTCCATCTGCGCCCTGG - Intergenic
1168983517 20:2027348-2027370 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1169119324 20:3085602-3085624 GGGCAGGTACATCTCAGGCCTGG + Intergenic
1169345173 20:4823391-4823413 GGGCTGCTTCAGCTGCGCCTCGG + Intronic
1170221444 20:13946666-13946688 GGGCGGCTACAGCTGTGCCCAGG - Intronic
1171427963 20:25060189-25060211 GGACAGCTTCATCCTCGCCCTGG - Intergenic
1171536615 20:25898534-25898556 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
1171839556 20:30193799-30193821 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
1173345049 20:42191613-42191635 CTGCAGCTACCTCTGTGCCCAGG - Intronic
1173524544 20:43721720-43721742 GGGCCGCTGCAGCTGCACCCAGG + Intergenic
1174111700 20:48201870-48201892 TGCCAGCCACAGCTGCGCCCTGG - Intergenic
1174133103 20:48359733-48359755 GGGCAGCAGCATCAGCACCCCGG - Intergenic
1175064310 20:56272390-56272412 GGGCAGCTGCAGCTGCACCTGGG - Intergenic
1175065005 20:56277064-56277086 AGGCAGCTGCATCTGCACCTGGG - Intergenic
1175138441 20:56842326-56842348 GGGCAGCTGCAATTGCGCCTGGG - Intergenic
1175252236 20:57616630-57616652 GGGCAGCTGCATCTGCCCAGAGG + Intronic
1175445104 20:59014691-59014713 GGGCAGCTCCATCTGACCCCTGG + Intergenic
1175675767 20:60945572-60945594 GGGCAGCTGCAGCGGCACCCAGG - Intergenic
1175892579 20:62322109-62322131 GGGCCGCTGCAACTGCCCCCCGG - Exonic
1176239403 20:64068959-64068981 GGGCAGCTGCAGCTGCTGCCTGG - Intronic
1176265586 20:64207658-64207680 GGGCAGCTACAGCAGCTACCAGG + Exonic
1176790201 21:13311143-13311165 GGGCAGCTGCAGCTGCACCCGGG + Intergenic
1176790221 21:13311224-13311246 GGGCAGCTGCAGCAGCACCCGGG + Intergenic
1177396168 21:20538406-20538428 GGGTGGCTGCAGCTGCGCCCAGG + Intergenic
1177396187 21:20538487-20538509 GGGCAGCTGCAGCGGCACCCGGG + Intergenic
1177404227 21:20645389-20645411 GGGCAGCTATGGCTGCTCCCAGG - Intergenic
1177989394 21:28019433-28019455 GGGCAGCTGCAGCAGCACCCGGG + Intergenic
1178931164 21:36820340-36820362 GGGCAGCAGCAGCTGCGCCTGGG - Intronic
1181235164 22:21444197-21444219 GGGCAGCACCATCTGGGCCTAGG - Intronic
1181646213 22:24232924-24232946 GGGCTGGAACAGCTGCGCCCAGG + Exonic
1183316721 22:37141163-37141185 GGGTGGCTGCAGCTGCGCCCAGG - Intronic
1183316752 22:37141292-37141314 GGGTAGCTGCAGCTGTGCCCGGG - Intronic
949226234 3:1699438-1699460 GGGCAGCTGCAGCTGTGCCCAGG - Intergenic
949481012 3:4493653-4493675 GGGCAAAAACTTCTGCGCCCGGG - Intronic
950068889 3:10136390-10136412 AGGCAGCTCCACCTGCGCCCCGG - Intergenic
952793234 3:37217165-37217187 GGGCAGCTGCGGCTGCGCCCAGG - Intergenic
953784028 3:45897014-45897036 GGGCTGCTGCTTCTGAGCCCAGG + Intronic
954099446 3:48358055-48358077 GAGCGGCTACAGCTGCACCCAGG + Intergenic
954375832 3:50193747-50193769 GCGCAGCTACCTCTCCGACCTGG + Exonic
954853728 3:53625237-53625259 GGGCAGCTGCGTCTGAGCACTGG + Intronic
955112000 3:55958898-55958920 GGGAAGCTGCAGCTGTGCCCAGG + Intronic
957625763 3:82650565-82650587 GGGCAGTGGCAGCTGCGCCCGGG - Intergenic
957653231 3:83035744-83035766 GGGCAGCTGCAGCTGCACCTAGG + Intergenic
957775983 3:84757431-84757453 GGGCGGCTACTGCTGCACCCAGG + Intergenic
958161321 3:89819156-89819178 GGGCAGCTGCAGCTGTGTCCAGG + Intergenic
958195208 3:90235256-90235278 GGGCAGCTGCAGCTGCACTCAGG - Intergenic
958418621 3:93906661-93906683 GGGCAGCTGCAGCTGCACTCAGG - Intronic
960568091 3:119156504-119156526 GTGCAGCTACATGTTCTCCCAGG - Intronic
961493477 3:127273996-127274018 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
961493519 3:127274166-127274188 GGGTGGCTGCAGCTGCGCCCAGG - Intergenic
961545641 3:127630927-127630949 GGGCAGTTACAGCTGGGCCTGGG - Intronic
961791242 3:129378323-129378345 AGGCAGCTACAGCTGTGCCTGGG + Intergenic
961791261 3:129378415-129378437 GGGCAGCTACAGCCCTGCCCCGG + Intergenic
962824633 3:139089011-139089033 GAGCAGCTGCAGCTGTGCCCAGG + Intronic
963199074 3:142568621-142568643 GGGCGGCTGCAGCTGCACCCAGG - Intronic
963906217 3:150775145-150775167 GGGCGGCTGCAGCTGTGCCCAGG + Intergenic
964791900 3:160460537-160460559 GGACAGCTACAGCTGCACCCAGG + Intronic
964927375 3:161975408-161975430 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
965003592 3:162987726-162987748 AGGCAGCTCCACCTGCGGCCAGG + Intergenic
965206263 3:165721287-165721309 GGGCAGCTGCAGCTGCACCCGGG + Intergenic
966840032 3:184081074-184081096 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
967649990 3:191974004-191974026 GGGCAGCTGCAGCAGCACCCGGG + Intergenic
967946487 3:194808002-194808024 GGGGAGCTCCTTCTGCTCCCGGG - Intergenic
968980889 4:3848823-3848845 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
969303081 4:6308988-6309010 GGGCAGCTCCACCTGCAGCCCGG - Intergenic
971869492 4:32216649-32216671 GGGCAGCTACAGCTGTGCCTAGG + Intergenic
972106359 4:35493999-35494021 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
972203768 4:36747454-36747476 GGGCAGCTACAGCCCCGCCCAGG - Intergenic
972344713 4:38182976-38182998 GGGCAGCTCCACCTGCCGCCTGG + Intergenic
972358374 4:38303648-38303670 GGGCAGCTGCAACTGTGCCAGGG + Intergenic
973765024 4:54155078-54155100 AGGCAGCTCCACCTGCGGCCTGG - Intronic
974179058 4:58360914-58360936 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
974278539 4:59759476-59759498 GGACAGCTGCAGCTGTGCCCAGG + Intergenic
974420047 4:61662259-61662281 GGGCAGCTACAGCTGTGCCTGGG - Intronic
974514904 4:62896949-62896971 GGGCAGCTTCAGCTGTGCCTGGG - Intergenic
974683598 4:65195495-65195517 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
974756909 4:66221394-66221416 GGGCATTTACACCTGCTCCCAGG + Intergenic
975439879 4:74399018-74399040 AGGCAGCTCCACCTGCGGCCCGG - Intergenic
976129570 4:81870511-81870533 GGGCAGCTGCAGCTGCACCCAGG - Intronic
976389275 4:84492960-84492982 GGGCAGCGGCCTCAGCGCCCGGG - Exonic
976680052 4:87746080-87746102 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
976728989 4:88244107-88244129 GGGCGGCTGCAGCTGCACCCGGG - Intergenic
977410183 4:96653069-96653091 GGGCAGCTGCAGCTGCTCCCAGG - Intergenic
977885698 4:102250250-102250272 AGGCAGCTCCACCTGCGCCCCGG - Intergenic
978061351 4:104344521-104344543 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
978219844 4:106256649-106256671 AGGCAGCTGCAACTGTGCCCGGG + Intronic
978663525 4:111155057-111155079 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
979010693 4:115365442-115365464 GGGCAGCTGCAGCTACGCCTGGG - Intergenic
979638052 4:122978992-122979014 GGGCAGCTGCAGCTGTGCCTGGG + Intronic
980574468 4:134666826-134666848 GGGCAGCCGCAGCTGGGCCCAGG + Intergenic
980731041 4:136824325-136824347 GGGCGGCTGCAGCTGCACCCTGG + Intergenic
980738124 4:136917495-136917517 GGGTAGCTGCAGCTGCACCCAGG - Intergenic
980750182 4:137077435-137077457 GGGCAGCTTCAGCTGCACCAGGG + Intergenic
982358148 4:154491276-154491298 GGGAAGCTCCTTCTGCTCCCCGG - Intronic
982545062 4:156724053-156724075 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
982863462 4:160482175-160482197 AGGCAGCTCCACCTGTGCCCCGG + Intergenic
983617562 4:169724931-169724953 GGGCAGCAGCATCTGAGCCCAGG + Intergenic
984170302 4:176350801-176350823 GAGCAGCTGCAGCTGCACCCTGG + Intergenic
985409105 4:189664693-189664715 AGGCAGCTCCACCTGCGGCCAGG - Intergenic
985523415 5:389711-389733 GGGCCGCCATATCTGCGCCCTGG - Intronic
985591434 5:767336-767358 GTCCAGCTTCAGCTGCGCCCTGG - Intergenic
986152074 5:5138192-5138214 AGGCAGCTCCACCTGCGCCCCGG + Intergenic
986661825 5:10065910-10065932 AGGCAGCTCCACCTGCGGCCCGG + Intergenic
987816092 5:22902160-22902182 GGGTGGCTGCAGCTGCGCCCAGG + Intergenic
988109939 5:26807425-26807447 GGGCATCTGCAGCTGTGCCCAGG - Intergenic
988143000 5:27267205-27267227 GGGCAGCTCCGCCTGCACCCCGG - Intergenic
988202156 5:28082868-28082890 GGGCAGCTGCAGCTGCACCTGGG - Intergenic
989339058 5:40354190-40354212 GGGCAGTTGCAGCTGCGCCCAGG - Intergenic
990023623 5:51159543-51159565 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
990323101 5:54648972-54648994 AGGCAGCTCCATCTGCTGCCTGG - Intergenic
990510106 5:56481823-56481845 GGCCAGCTCCACCTGCGACCTGG - Intronic
990512073 5:56498613-56498635 AGGCAGCTCCACCTGCGGCCTGG - Intergenic
990665646 5:58069092-58069114 TGGCAGCTCCGTCTGTGCCCCGG - Intergenic
990923594 5:60994397-60994419 GGGCAGCTGCAGCTGCACCTGGG + Intronic
991107792 5:62862767-62862789 GGGCAGCTACAGCAGCACCTGGG + Intergenic
991359439 5:65803752-65803774 GGGCAGCTGCAGCTATGCCCAGG + Intronic
992839050 5:80668838-80668860 GGGCAGCCACAGCTGTGCCCAGG + Intronic
994451478 5:99950180-99950202 GGGCAGCTGCAGCTGCGCCCAGG - Intergenic
994851141 5:105056952-105056974 GGGCAACTACAGCTGCACCCAGG - Intergenic
995145915 5:108787064-108787086 GGGCAGCTGCAGCTGCACCCAGG - Intronic
995206588 5:109487803-109487825 GGGCAGCTCCGCCTGCGCCCTGG - Intergenic
996815636 5:127569819-127569841 AGGCAGCTCCACCTGCGGCCAGG + Intergenic
997960334 5:138316119-138316141 GGGCAGCTGCAGCTGCACCCGGG - Intronic
999348613 5:150845833-150845855 AGGCAGCTTCACCTGCGGCCTGG + Intergenic
1000266157 5:159640534-159640556 GGGCAGCTGCAGCTGCACTCAGG - Intergenic
1000426140 5:161093491-161093513 GGGCAGCTGCAGCTGCACCCTGG - Intergenic
1000854347 5:166379828-166379850 GGGTAGCTGCAGCTGCGCCCAGG + Intergenic
1001841615 5:174881078-174881100 AGGCAGCTCCACCTGAGCCCAGG + Intergenic
1002797858 6:489922-489944 GGGCATCTCCAGCTGCTCCCGGG + Intronic
1003178550 6:3771999-3772021 GGGCAGCTCCACCTGCGCCCCGG + Intergenic
1005021571 6:21423708-21423730 GGGCAGCTGCAGCTGCACCCAGG + Intergenic
1005043563 6:21620768-21620790 GGGCAGCTGCAGCAGCACCCTGG + Intergenic
1005766388 6:29015487-29015509 GGGCAGCTCCGCCTGCGGCCCGG + Intergenic
1005775702 6:29129429-29129451 GGGCAGCTGCAACTGAGCCTGGG - Intergenic
1005775725 6:29129519-29129541 GAGCAGCTGCAGCTGCACCCGGG - Intergenic
1005781827 6:29201120-29201142 GGGCATCTGCAGCTGCGCCCAGG - Intergenic
1006044858 6:31286596-31286618 GAGCAGCTGCATGTGGGCCCTGG - Intronic
1006347887 6:33498016-33498038 GGGCAGCTGCAGCTGCAACCAGG - Intergenic
1008330755 6:50241198-50241220 GGGCGGCTGCAGCTGCACCCGGG + Intergenic
1009471477 6:64031530-64031552 AGGCAGCTCCACCTGCGGCCCGG + Intronic
1009530324 6:64803953-64803975 GGGTGGCTGCAGCTGCGCCCGGG + Intronic
1009871088 6:69452484-69452506 GGGTGGCTACAGCTGTGCCCAGG + Intergenic
1010883951 6:81214899-81214921 GGGCGGCTACAGCTGCACCTGGG - Intergenic
1011284278 6:85706675-85706697 GGGCAGCCACAGCTGCACCCAGG + Intergenic
1012052406 6:94361831-94361853 GGGCATCTGCAGCTGCACCCAGG + Intergenic
1012752680 6:103183805-103183827 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
1014505434 6:122248470-122248492 GGCCAGCTGCAGCTGCGCCCAGG + Intergenic
1015148909 6:130018421-130018443 GGGCAGCTGCATTTGCCACCCGG + Exonic
1015434639 6:133172204-133172226 GGGCAGCCCCAGCTGCACCCAGG - Intergenic
1016339784 6:143049946-143049968 GGGCAGCTGCAGCGGCACCCAGG + Intergenic
1016758982 6:147716546-147716568 GGGCAGCCACAGCTGCACCCAGG + Intronic
1018676843 6:166229538-166229560 GGGCAGCTACCCCAACGCCCTGG - Intergenic
1020445359 7:8262084-8262106 GGGCAGGTACCTCGGAGCCCCGG + Exonic
1020568114 7:9822791-9822813 GAGCAGCCACAGCTGTGCCCAGG + Intergenic
1021097147 7:16547475-16547497 GGGCAGCTGCAGCTGTGCCTAGG - Intronic
1021343227 7:19489567-19489589 GGGCAGCTGCAACTGCACCTGGG + Intergenic
1021561490 7:21972398-21972420 GGGCAGCCACAGCTGCATCCAGG + Intergenic
1023089524 7:36604665-36604687 GGGCAGCTACCTCAGACCCCAGG + Intronic
1023789017 7:43737387-43737409 GGGCAGCTGCAGCTGCACCTGGG - Intergenic
1023789046 7:43737511-43737533 GGGCAGCCACAGCTGCACCTGGG - Intergenic
1023790614 7:43750283-43750305 GGGCAGCTGCATCGGGACCCAGG + Intergenic
1024786334 7:52911593-52911615 GGGCAGCCACAGCTGTGCCTGGG + Intergenic
1024794414 7:53004338-53004360 AGGCAGCTCCACCTGCGGCCAGG + Intergenic
1025288088 7:57685242-57685264 GGGCAGCTGCAGCGGCACCCAGG - Intergenic
1026370285 7:69691688-69691710 GGGCAGCTGCAGCTGTGCCCAGG + Intronic
1026392138 7:69912334-69912356 GGGCAGCTGCATGTGTGCCCAGG + Intronic
1027220656 7:76211685-76211707 GGGCAGGTACCTCTGCACCTAGG - Intronic
1027735035 7:81920952-81920974 GGGCAGCTGCAGCTGCACCCAGG + Intergenic
1028136657 7:87230160-87230182 GGGCAGCTGCAGCTGCACCCAGG - Intergenic
1028303231 7:89228721-89228743 AGGCAGCTCCACCTGCACCCCGG - Intronic
1028596010 7:92546959-92546981 GGGCAGCGGCAGCTGTGCCCAGG - Intergenic
1028817001 7:95157465-95157487 GGGCAGCTGCAGCTGCACCCGGG + Intronic
1029899182 7:104021940-104021962 GGGCAGCTGCAGTTGTGCCCAGG - Intergenic
1029973880 7:104814979-104815001 GGGCAGCTGCAGCTGCGCCTGGG + Intronic
1030102065 7:105955763-105955785 AGGCAGCTCCACCTGCGGCCGGG - Intronic
1030113696 7:106047547-106047569 GGGCAGCTACATCTTCCCCTGGG + Intergenic
1031836345 7:126685419-126685441 GAGCAGCTGCAGCTGCACCCAGG - Intronic
1032017642 7:128389920-128389942 GGGCAGCGGCATCTGCGCAAAGG - Intergenic
1034210506 7:149358624-149358646 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
1034931507 7:155167301-155167323 GGGCTGCTTCACCTGCGCCAGGG - Intergenic
1035385996 7:158473390-158473412 GGGAGGCTACATCCACGCCCAGG + Intronic
1035463826 7:159063099-159063121 GGGCAGCTCCGCCTGCGGCCCGG - Intronic
1037150142 8:15626542-15626564 GGACAGTTGCAGCTGCGCCCAGG - Intronic
1038916586 8:32031224-32031246 GGGCAGCAGCCTCTGTGCCCAGG + Intronic
1040715731 8:50249434-50249456 GGGCAGGTACATGTGAGTCCAGG - Intronic
1040946741 8:52892930-52892952 GGGCAGCTTCATCTTCCCGCTGG - Intergenic
1041383837 8:57278981-57279003 TGGCAGCTGCAGCTGAGCCCAGG - Intergenic
1041956292 8:63560315-63560337 GGGCAGCTGCAGCTGCATCCAGG + Intergenic
1042624991 8:70748265-70748287 GGGCAGCTACATCTGCGCCCAGG - Intronic
1043082673 8:75785139-75785161 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1043745477 8:83869186-83869208 GGGCAGCTGCAGCTGCACCTGGG - Intergenic
1043756157 8:84005987-84006009 GGGCAGCTGCAGCTGCGCCCGGG + Intergenic
1043798765 8:84579399-84579421 GGTCAGCTGCAGCTGTGCCCAGG + Intronic
1044775087 8:95678766-95678788 GGGCAGCCACAGCTCTGCCCAGG + Intergenic
1046149277 8:110202529-110202551 AGGCAGCTCCACCTGCGGCCCGG - Intergenic
1046459805 8:114518409-114518431 GGGCAGCTGCAGCTGTGCTCAGG + Intergenic
1047544049 8:125797954-125797976 GGGCAACTGCAGCTGTGCCCAGG + Intergenic
1048112921 8:131487435-131487457 AGGCAGCTCCACCTGCACCCCGG + Intergenic
1048989746 8:139754342-139754364 GGGCTCCCACATCTGCTCCCAGG + Intronic
1049698777 8:143997057-143997079 GGGAAGCAGCATCTGGGCCCTGG - Intronic
1049826954 8:144675027-144675049 AGGCAGCTGCAGCTGTGCCCAGG + Intergenic
1050589808 9:7149435-7149457 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
1050808788 9:9718501-9718523 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1050937153 9:11413342-11413364 AGGCAACTGCAGCTGCGCCCAGG - Intergenic
1051449333 9:17178366-17178388 AGGCAGCTCCACCTGCGGCCCGG - Intronic
1052623386 9:30943680-30943702 GGGCAGCTACAGCTGCATCTGGG - Intergenic
1052633648 9:31071983-31072005 GGGCAGCCTCATGTGCACCCGGG + Intergenic
1053900702 9:42793011-42793033 GGGCAGCTACCCTTGCGCCTGGG - Intergenic
1056192114 9:84194745-84194767 GGGCAGCCACAGCTGCACTCAGG + Intergenic
1056677186 9:88685878-88685900 AGGCAGCTCCACCTGCGGCCTGG - Intergenic
1056774850 9:89503954-89503976 TTGCAGCTACATGTGGGCCCAGG - Intergenic
1057023514 9:91718806-91718828 TGGCAGCTACAACTTCTCCCAGG - Intronic
1057171593 9:92966268-92966290 GGGCAGCCACATCTGGGTCTGGG + Intronic
1057548372 9:96034712-96034734 GGGCAGCTGCAGCAGCACCCAGG - Intergenic
1060618729 9:125043919-125043941 GGGTAGCTGCAGCTGCACCCAGG - Intronic
1060739658 9:126089989-126090011 GGGCAGCTGCATCCCAGCCCTGG - Intergenic
1062329024 9:136028678-136028700 GGGCAACTGCAGCTGCGCCTGGG - Intronic
1062511376 9:136908000-136908022 GGGCAGCCACAGCTTCACCCGGG - Intronic
1062527951 9:136985806-136985828 GGCCAGGTACATGGGCGCCCTGG + Intronic
1203612465 Un_KI270749v1:21769-21791 GGGCAGCTGCAGCAGCACCCAGG + Intergenic
1185563353 X:1077572-1077594 GTGCAGCGACATCTGGGTCCAGG + Intergenic
1186805756 X:13139109-13139131 GGGCAGATGCAGCTGCGCCTAGG - Intergenic
1188727882 X:33607445-33607467 GGGTGGCTACAGCTGCACCCAGG + Intergenic
1189023764 X:37370491-37370513 GGGTGGCTACAGCTGTGCCCTGG - Intronic
1189023790 X:37370582-37370604 GGGCAGTTGCAGCTGCACCCAGG - Intronic
1189023812 X:37370673-37370695 GGGCAGCTACAGCTGTGCCTGGG - Intronic
1189324754 X:40105624-40105646 GGGCAGGAACACCTGCTCCCAGG + Intronic
1189360109 X:40343670-40343692 GGGCAGCCTCAGCTGCACCCAGG - Intergenic
1190369398 X:49726862-49726884 GGGCAGCTGCAGCTGCACCAGGG - Intergenic
1190681589 X:52830995-52831017 GGGCAGCTGCAGGTGCACCCAGG - Intergenic
1192174629 X:68878071-68878093 AGGCACCTCCATCTGTGCCCTGG - Intergenic
1192265426 X:69534158-69534180 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
1193108590 X:77704985-77705007 GGGCAGCTATAGCTGTGCCCAGG + Intronic
1193708903 X:84856599-84856621 AGGCAGCTCCACCTGCGGCCCGG - Intergenic
1195454347 X:105051351-105051373 GGGCAGCCGCAGCTGCACCCAGG + Intronic
1199188094 X:144939872-144939894 GGGCAGCTGCAGCTGCACCTGGG + Intergenic
1199559378 X:149146862-149146884 GGGTGGCTACAGCTGCACCCGGG - Intergenic
1199614633 X:149647204-149647226 GGGTAGCTGCAGCTGCACCCAGG - Intergenic
1202073589 Y:21016822-21016844 GGACAGCTGCAGCTGTGCCCAGG + Intergenic
1202078289 Y:21058676-21058698 GGACAGCTGCAGCTGTGCCCAGG + Intergenic
1202272545 Y:23085602-23085624 GGGCAGCTCCACCTGCCTCCCGG - Intergenic
1202293481 Y:23335080-23335102 GGGCAGCTCCACCTGCCTCCCGG + Intergenic
1202425542 Y:24719346-24719368 GGGCAGCTCCACCTGCCTCCCGG - Intergenic
1202445247 Y:24950739-24950761 GGGCAGCTCCACCTGCCTCCCGG + Intergenic