ID: 1042624992

View in Genome Browser
Species Human (GRCh38)
Location 8:70748285-70748307
Sequence CCAGGTCTAGAGCTGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 5, 2: 17, 3: 54, 4: 304}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042624992_1042624999 -2 Left 1042624992 8:70748285-70748307 CCCAGCTGCAGCTCTAGACCTGG 0: 1
1: 5
2: 17
3: 54
4: 304
Right 1042624999 8:70748306-70748328 GGGCATCCCTGCACTCGCAGGGG No data
1042624992_1042625005 25 Left 1042624992 8:70748285-70748307 CCCAGCTGCAGCTCTAGACCTGG 0: 1
1: 5
2: 17
3: 54
4: 304
Right 1042625005 8:70748333-70748355 GGAAGCCCCCTTCCCCCCACAGG No data
1042624992_1042625001 4 Left 1042624992 8:70748285-70748307 CCCAGCTGCAGCTCTAGACCTGG 0: 1
1: 5
2: 17
3: 54
4: 304
Right 1042625001 8:70748312-70748334 CCCTGCACTCGCAGGGGCCCAGG No data
1042624992_1042624998 -3 Left 1042624992 8:70748285-70748307 CCCAGCTGCAGCTCTAGACCTGG 0: 1
1: 5
2: 17
3: 54
4: 304
Right 1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG No data
1042624992_1042625007 30 Left 1042624992 8:70748285-70748307 CCCAGCTGCAGCTCTAGACCTGG 0: 1
1: 5
2: 17
3: 54
4: 304
Right 1042625007 8:70748338-70748360 CCCCCTTCCCCCCACAGGCTTGG No data
1042624992_1042624997 -4 Left 1042624992 8:70748285-70748307 CCCAGCTGCAGCTCTAGACCTGG 0: 1
1: 5
2: 17
3: 54
4: 304
Right 1042624997 8:70748304-70748326 CTGGGCATCCCTGCACTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042624992 Original CRISPR CCAGGTCTAGAGCTGCAGCT GGG (reversed) Intronic
900653217 1:3741514-3741536 CCGGCCCTAGAGCTGCTGCTCGG + Intergenic
901801061 1:11708206-11708228 CCAGCTCCAGGGCTGCAGCCAGG + Intronic
902242553 1:15098749-15098771 CCAGTTCAGGAGCTCCAGCTGGG + Intronic
902328122 1:15716067-15716089 CCAGTGCCAGAGCAGCAGCTGGG + Intronic
902922178 1:19672545-19672567 CCAGGGCTGGAGCAGGAGCTTGG + Intronic
903068590 1:20715446-20715468 GCAGGGCCAGAGCTGCAGCTGGG - Intronic
903410640 1:23140598-23140620 CCAGGGCTAGAAAGGCAGCTCGG - Intronic
903647972 1:24906086-24906108 CCAGGCATAGTGCTGCAGCCAGG - Intronic
904377481 1:30090771-30090793 CCAGGATTACAGCTGCAGATGGG - Intergenic
904683920 1:32247516-32247538 CCGAGTCTGCAGCTGCAGCTTGG - Exonic
904732825 1:32607423-32607445 CCAGGTCTGGAGCCGCAGCTGGG + Intronic
905347101 1:37318671-37318693 GCAGGTCCAGAGCTGCCGCTGGG + Intergenic
907487421 1:54787477-54787499 CCAGGTCATGAGCTGCAGACGGG + Intronic
907705676 1:56830537-56830559 CCAGGTCTAAGGCTTCATCTAGG + Intergenic
907985236 1:59524013-59524035 CCAGGTCCAGAGCCGCAGCTGGG - Intronic
908259428 1:62327854-62327876 CCAGGTCTGCAGCTGCTGGTCGG + Intergenic
910259738 1:85283787-85283809 CCAGGTCTGGAGCTGTGCCTGGG - Intergenic
911288790 1:96029267-96029289 TCAGGTCTGCAGCTGCAGCTGGG + Intergenic
911357925 1:96844345-96844367 ACAGGCCTAGAGCTCCAGCCAGG + Intergenic
911434888 1:97844759-97844781 CCAGGTCTGGAGCCACAGCTGGG - Intronic
911475491 1:98367548-98367570 CCAGGTCCAGAGCTGTGGCTGGG + Intergenic
912132418 1:106619410-106619432 CCAGGACTGCAGCTGCAGTTTGG - Intergenic
912881931 1:113424050-113424072 CCCAGTCTGGAGCTGCTGCTGGG + Intronic
912956294 1:114155975-114155997 CCAGGTCCGGAGCTGCTGCCGGG - Intergenic
913202960 1:116510978-116511000 CCAGGTGCTGGGCTGCAGCTAGG + Intergenic
914392876 1:147237478-147237500 CCAGGTCTGCAGCTGCAGCTGGG + Intronic
915828853 1:159106174-159106196 CTGGGTCCGGAGCTGCAGCTGGG + Intronic
919083338 1:192891829-192891851 CCAGGTCTACAGCTATAGTTTGG + Intergenic
919205831 1:194420804-194420826 CCAGGTCTGCAGATGCAGCTGGG + Intergenic
919621137 1:199865794-199865816 CCAGCCCTTGAGCTGCTGCTCGG - Intergenic
919667122 1:200302706-200302728 GCAAGTCTAGATCTGCAACTGGG - Intergenic
919748962 1:201024774-201024796 CCACATCTGGGGCTGCAGCTGGG - Intergenic
919943557 1:202304477-202304499 TCAGGTCCAGAGCTGGAGCGGGG + Intronic
921548532 1:216503477-216503499 CCATGTCTATAGCTGTAGATGGG - Exonic
922569364 1:226624720-226624742 CCAGGCCCCGGGCTGCAGCTGGG + Intergenic
923328050 1:232898229-232898251 CCAGGTCCACAGCTGCAGCTGGG - Intergenic
923949525 1:238932488-238932510 CCAGTTCTGGAGCTGGAGTTGGG - Intergenic
924672946 1:246147751-246147773 CCAGGTCTGCAGCCGCAGCAGGG - Intronic
1065182499 10:23140580-23140602 CCATGTCTAGAACATCAGCTTGG - Intergenic
1066055676 10:31678166-31678188 CGAGGTCTGGAACTGCAGATTGG - Intergenic
1066101627 10:32122948-32122970 CTAGGTCTGCAGCTGCAGTTTGG + Intergenic
1067239362 10:44477159-44477181 CCTGGTCCAGGGCTGCAGCTGGG + Intergenic
1067258799 10:44667680-44667702 CCAGGTCTGGAGCCATAGCTGGG + Intergenic
1067343488 10:45422092-45422114 CCAGGTCTAGGGGTGCATCCAGG - Intronic
1068283775 10:54909624-54909646 CCTGGCCCATAGCTGCAGCTTGG + Intronic
1069212411 10:65779020-65779042 CCTGGTCCAGAGCTGCAGCTGGG - Intergenic
1069952569 10:72029646-72029668 TCTGGACTTGAGCTGCAGCTGGG + Intergenic
1070401493 10:76056805-76056827 CTGGGTCTGCAGCTGCAGCTGGG + Intronic
1071819533 10:89265265-89265287 CTAGGTCTGCAGCTACAGCTGGG + Intronic
1073050310 10:100662858-100662880 CCAGGTCAAGAGCAGCCTCTGGG - Intergenic
1074028627 10:109663145-109663167 CCAGGTCCACAGCTGTGGCTTGG - Intergenic
1074028646 10:109663236-109663258 CTAGGTCTGCAGCTGCAACTTGG - Intergenic
1074715757 10:116217128-116217150 CCAGGTCCAGACCTGCAGGTGGG + Intronic
1075351303 10:121727068-121727090 CCAGGTCTGGTTCTGCACCTAGG + Intergenic
1075923797 10:126234968-126234990 CCAGGTCTGATGCTGCAGGTGGG + Intronic
1077494799 11:2881763-2881785 CCAGGCCTCCTGCTGCAGCTGGG - Intergenic
1077938750 11:6817951-6817973 CCAGGTCTGCAGCTGCAGTTAGG - Intergenic
1078042888 11:7884519-7884541 CCAGGTCTACAGCTGCAGTGTGG + Intergenic
1078303217 11:10156035-10156057 CCGGGTCCAGAGCTGCAGCTGGG - Intronic
1078978580 11:16505772-16505794 CCATGGCTGGAGCTGGAGCTGGG - Intronic
1079184244 11:18221715-18221737 CCAGGTCCACAGCCACAGCTTGG + Intronic
1079673935 11:23202192-23202214 CCAGGTCCAGAGCTGTGTCTGGG - Intergenic
1080333817 11:31174074-31174096 CTGGGTCTGCAGCTGCAGCTGGG - Intronic
1080333838 11:31174164-31174186 CTGGGTCTGCAGCTGCAGCTGGG - Intronic
1080590871 11:33722281-33722303 CCAGGCCTGGAGGAGCAGCTGGG + Intronic
1081620778 11:44618158-44618180 CCAGGTGAAGTGCTGCGGCTGGG + Exonic
1082067837 11:47915362-47915384 CTAGGTCCAGATCTGAAGCTTGG + Intergenic
1082687808 11:56260854-56260876 CCAGGTCTGGAGCCACAGCTGGG + Intergenic
1083915962 11:65744045-65744067 TGGGGTCTGGAGCTGCAGCTGGG - Intergenic
1084156252 11:67314403-67314425 CCTGGCCTAGGGCTGCAGATGGG + Intergenic
1084641643 11:70429878-70429900 CCAGGTGTGGTTCTGCAGCTGGG + Intronic
1086085193 11:82946082-82946104 CCAGGTCCACAGCTGCAGTTTGG + Intronic
1086947159 11:92854337-92854359 CCAGGTCCAGAGCTGTGGCTGGG + Intronic
1087339038 11:96878780-96878802 CCAGGTCCAGAGCAGTGGCTGGG + Intergenic
1088495171 11:110424978-110425000 CCTGGTCAAGATCTGCAGCCTGG + Intergenic
1091392475 12:134035-134057 CCAGGTGCAAAGCTGCAGATAGG + Intronic
1092075707 12:5671616-5671638 CCAGCCCCAGAGCTGCAGATGGG - Intronic
1093493182 12:19726871-19726893 CAGGGTCCACAGCTGCAGCTTGG + Intergenic
1093502525 12:19828442-19828464 CCAGGTCTGGAGTTGTGGCTGGG + Intergenic
1094282482 12:28755103-28755125 CCACGGCTTGAGCTGCACCTTGG + Intergenic
1095213624 12:39523364-39523386 CCAGGTCTAGAGATGCACACAGG - Intergenic
1097536229 12:60873361-60873383 CCGGGTCTAGAGCTGTGGCTTGG + Intergenic
1099233901 12:80059203-80059225 CCAGGTCTGAGGCTGCAGCTGGG + Intergenic
1100847751 12:98678457-98678479 CCAGGTCCACAGCTGTGGCTTGG - Intronic
1101678804 12:106944303-106944325 CATGGTATGGAGCTGCAGCTGGG - Intergenic
1101764114 12:107682684-107682706 CCAGATCCACAGCTGCAGTTTGG + Intergenic
1102013266 12:109631907-109631929 CAAGGTCTAGAGTGGCAGCCAGG + Intergenic
1102036344 12:109772421-109772443 TCAGGGCTAGAGCCCCAGCTGGG - Intergenic
1105277999 13:18947414-18947436 CCAGGGCTAGTTCTGCAGTTGGG - Intergenic
1106999668 13:35527755-35527777 CCAGGTCCAGAGCCACAGCTGGG + Intronic
1107744379 13:43489346-43489368 CAGGGTTTACAGCTGCAGCTGGG - Intronic
1107841025 13:44458597-44458619 CCAGGTCTGGAGGTACGGCTGGG - Intronic
1107927606 13:45278462-45278484 TCAGATCTTGTGCTGCAGCTTGG + Intronic
1108023225 13:46150762-46150784 CCAGGACTAGAGCAGCAGATGGG + Intronic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1108489588 13:50967882-50967904 CCAGGTCTAGAGAAGCAAGTGGG + Intronic
1109525144 13:63566069-63566091 CTGGGTCCATAGCTGCAGCTTGG - Intergenic
1109687688 13:65843389-65843411 CCAGGTCCAGAGCTGTGGTTGGG - Intergenic
1111202944 13:84962503-84962525 CCAGGTCTGGAGCCGCGGCTGGG + Intergenic
1111347202 13:86974500-86974522 CCTGGTCCAGAGCTGCTGCTGGG - Intergenic
1111546275 13:89741213-89741235 CCGGGTACAGAGCTGCGGCTGGG - Intergenic
1111595277 13:90403599-90403621 CCAGGTCCACAGCCACAGCTAGG - Intergenic
1115059022 14:29168383-29168405 CCTGGTCCAGAGCTGCAGCTGGG - Intergenic
1116317080 14:43410751-43410773 CCAGGTCTGTAGCTGCAGCCAGG + Intergenic
1119257281 14:73209137-73209159 CCAGGTCTACAGCCACAGCTGGG + Intronic
1119796634 14:77404028-77404050 CCAGGTATAGAATTGCAGGTTGG - Intronic
1120745395 14:88147075-88147097 CCAGGTCTGCAGCTGCTGGTTGG - Intergenic
1121347594 14:93147567-93147589 CCAAGACTAGAGATGCTGCTGGG + Intergenic
1121922850 14:97899169-97899191 CCAGGTCTGGAGATGCCTCTGGG - Intergenic
1121973962 14:98385525-98385547 CCAGGTCTGCAGCTGCGGGTTGG - Intergenic
1122102641 14:99425450-99425472 CCAGGTTCAGAGCTGGCGCTGGG - Intronic
1122159791 14:99774570-99774592 CCAGGGCTAGAGCAGGGGCTTGG - Intronic
1122479010 14:102033712-102033734 ACAGGTCTGGAGCTGCTGGTGGG - Intronic
1122805283 14:104253364-104253386 TCAGGTCGAGAGCTGCAGCCAGG + Intergenic
1123886083 15:24729444-24729466 AAAGCTCTAGAGCTGCAGCCTGG + Intergenic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1125720995 15:41845099-41845121 CCAGGGCAAGGGCTGGAGCTGGG + Intronic
1126215119 15:46145965-46145987 CTGGGTCTACAGCTGCAGCTGGG - Intergenic
1126850891 15:52796150-52796172 CAAGGTCCAGGGGTGCAGCTAGG + Intergenic
1127639491 15:60902513-60902535 CCAGGCCTAGAGAAGCAGCACGG + Intronic
1128179700 15:65590977-65590999 CCAGGTGTAGAGATCCAACTAGG + Intronic
1128965170 15:72051492-72051514 CTGGGTCTGCAGCTGCAGCTTGG - Intronic
1129616679 15:77104408-77104430 CCAGGCCAGGAGCTGAAGCTGGG + Exonic
1130350484 15:83087034-83087056 CCTGGTTTTGAACTGCAGCTGGG + Intergenic
1131066870 15:89440112-89440134 CTAGGCATAGAGATGCAGCTGGG - Intergenic
1131832282 15:96361436-96361458 CCAGGTCTAGAGATGCGGGCAGG + Intergenic
1131941193 15:97567659-97567681 ACAGAGCTAGAGCTGCAGCATGG - Intergenic
1132035801 15:98483166-98483188 CCAGCTCTGGTGCTGCAGGTGGG - Intronic
1132661205 16:1062308-1062330 CCAGGGCCGGAGCTGCAGCCGGG - Intergenic
1132712233 16:1274151-1274173 CCAGGTCCTGAGCTGAGGCTGGG - Intergenic
1132978913 16:2724932-2724954 CCCGGTCTGCAGCTACAGCTGGG - Intergenic
1133302642 16:4792151-4792173 CCAGGCCAAGAGCTGGAGCAGGG + Intronic
1135119603 16:19754156-19754178 CCAGGTCAGGAGCTGCAGGGTGG + Intronic
1136628976 16:31478185-31478207 CCAGGACAAGAGCTCCAACTGGG + Intergenic
1137343791 16:47636450-47636472 CTGGGTCTGGAGCTGCGGCTGGG - Intronic
1137563025 16:49515175-49515197 CCTGGCCTCGAGCTGCAGCCTGG + Intronic
1137807458 16:51320891-51320913 CCAGGTCTAGGCCTGAACCTTGG + Intergenic
1137807689 16:51322823-51322845 CCAGGTCTAGGCCTGAACCTTGG + Intergenic
1139268546 16:65661452-65661474 CTAGGTCCAGAGCTGGAGTTTGG + Intergenic
1139463737 16:67142716-67142738 CAGGGTCTGGAGCTGCAGCTGGG + Intronic
1139625960 16:68188367-68188389 CCGGGTCAGCAGCTGCAGCTGGG + Intronic
1139719500 16:68841199-68841221 CTGGGTCTAGAACTGCAGATGGG - Intergenic
1140103387 16:71938093-71938115 CCAGGTCTGCAGCTGTGGCTGGG - Intronic
1142199814 16:88755765-88755787 CCAGGCCAAGAGCTGCAGAGCGG + Intronic
1144206727 17:12984709-12984731 CCAGGGGAGGAGCTGCAGCTGGG - Exonic
1144670625 17:17130712-17130734 CCAGGCCCAGGGCTGGAGCTGGG + Intronic
1146114548 17:30123231-30123253 CTAGGACTACAGGTGCAGCTGGG + Intronic
1149169364 17:53791780-53791802 CTGGGTCTGGAGCTGCAGCTGGG - Intergenic
1150749410 17:67846385-67846407 CCTGGTCTAGAGATACATCTAGG - Intronic
1151423618 17:74015365-74015387 CAATGTCTGGAGCTTCAGCTGGG + Intergenic
1151772277 17:76171850-76171872 CCTATTCTAGAGCTGCAGCCAGG + Intronic
1152109109 17:78347577-78347599 CAAGGTCTCTTGCTGCAGCTGGG + Intergenic
1153472982 18:5467910-5467932 CCAAATCCACAGCTGCAGCTGGG - Intronic
1153608057 18:6854766-6854788 CCGGGTCCAGAGCTGCAGGTGGG - Intronic
1155057817 18:22200534-22200556 CCAGGGCCAGAGCTGCTCCTGGG - Intronic
1155074559 18:22343233-22343255 GCAGGGCTAGAGCTCCAGCTAGG + Intergenic
1155215651 18:23641277-23641299 CCAGAACCGGAGCTGCAGCTGGG - Intronic
1155996785 18:32338999-32339021 CCTGGTAAAGAGCTGCAGTTTGG - Intronic
1158051515 18:53226272-53226294 TAAGGTCTAGATCAGCAGCTAGG + Intronic
1158774020 18:60555292-60555314 CCAGGTCTGGAGCTGCAGCTGGG - Intergenic
1159774375 18:72586038-72586060 CCAGGTCTGCAGCTGCAGCTGGG + Intronic
1160679385 19:405808-405830 CCAGGACTGGAGGAGCAGCTGGG - Exonic
1160834124 19:1116641-1116663 CCAGGTCTAAAGCAGAGGCTTGG - Intronic
1160986863 19:1843160-1843182 CCGGGCCCAGAGCCGCAGCTGGG + Intronic
1160986884 19:1843220-1843242 CCGGGCCCAGAGCCGCAGCTGGG + Intronic
1164189589 19:22901856-22901878 CCACGTCTAAGGCTCCAGCTGGG + Intergenic
1165829903 19:38725325-38725347 CGAGGTCAGGAGCTGCAGCCAGG + Intronic
1166120434 19:40683131-40683153 CCTGGTCTAGACATGCAGATGGG + Intronic
1167792703 19:51691142-51691164 CCAGGTCTGGAGCTGGGGGTGGG - Intergenic
1168556825 19:57350495-57350517 CCAGTTCTTGAACTTCAGCTAGG + Intergenic
1168701060 19:58439832-58439854 CCAGGGCTAGCCCTGCCGCTGGG + Exonic
926092796 2:10061449-10061471 CCAGGTCCAGAAGTGCTGCTTGG - Intronic
926547116 2:14255541-14255563 CCGGGTCCAGAGCTGTAGCTGGG + Intergenic
928444038 2:31317400-31317422 CCAGGTCCAGAGATGCAGCGTGG - Intergenic
928904378 2:36355487-36355509 CCGGGGCCAGAGCCGCAGCTCGG + Intergenic
929459729 2:42094190-42094212 CAAGGTCAAGAGCAGCATCTTGG + Intergenic
929847253 2:45542386-45542408 CCAGGTCCAGAGCTGTAGCTGGG + Intronic
930435364 2:51334183-51334205 CCAGATCTGGAACTGCAGTTGGG + Intergenic
930957161 2:57217053-57217075 CCAGGTCCACAGCTGTAGCTTGG - Intergenic
932524063 2:72444697-72444719 CCAGGGCCTGAGCTGTAGCTTGG + Intronic
933454805 2:82507709-82507731 GCAGGTCTGCAGCGGCAGCTGGG - Intergenic
933771163 2:85745050-85745072 CCAGGTCTACAGCTGTCCCTGGG + Intergenic
935667457 2:105525216-105525238 CCAGGTCCAGAGCTGCAGCTGGG - Intergenic
937041954 2:118829421-118829443 CCAGGACCACAGCTGCAGCAGGG + Intergenic
937737708 2:125312575-125312597 CTGGGTCTAGAGCTGTGGCTGGG - Intergenic
937969898 2:127541540-127541562 CCAGGTCTAAAACTGCAGGCTGG + Intronic
938137327 2:128770111-128770133 TCATGTCTAGAGCTCCAGCATGG + Intergenic
940694383 2:156959920-156959942 CTTGGTCTGCAGCTGCAGCTTGG + Intergenic
940957049 2:159739156-159739178 CCAAGTCTACAGCCACAGCTGGG + Intronic
941130950 2:161650537-161650559 CCAGATCCAGAGCCACAGCTAGG - Intronic
941433302 2:165437058-165437080 CATGGTATGGAGCTGCAGCTGGG - Intergenic
941998773 2:171626449-171626471 CTGGGTCTGGAGCTGTAGCTGGG - Intergenic
943085381 2:183304653-183304675 CCAGGTCTTCAGCAGCAGCAAGG - Intergenic
943226418 2:185184973-185184995 CTGGGTCCAGAGCTGCAACTGGG - Intergenic
943564697 2:189503912-189503934 TCAGGTTTACAGTTGCAGCTTGG - Intergenic
944483717 2:200182061-200182083 CTGGGTCTACAGCTGCAGTTTGG - Intergenic
945721193 2:213421113-213421135 CCAGGTCCAGAGCTGCAGCTGGG - Intronic
947327377 2:228992901-228992923 CCAGGTCTGTAGCTGTGGCTTGG + Intronic
947461250 2:230306494-230306516 CCAGGCCTACAGCTGCAACCTGG - Intronic
948661573 2:239510150-239510172 GCAGGCCTACAGCAGCAGCTCGG + Intergenic
948845819 2:240682378-240682400 CATGGCCCAGAGCTGCAGCTCGG - Exonic
948848038 2:240692352-240692374 CATGGCCCAGAGCTGCAGCTCGG + Exonic
1170802269 20:19600193-19600215 CAGGGTCTGGAGCTGGAGCTGGG - Intronic
1171285907 20:23937990-23938012 CCAGGTCTGGAGCTGCAGCTGGG - Intergenic
1173445606 20:43115286-43115308 CCTGGTTTAGACCTTCAGCTGGG + Intronic
1173851029 20:46218411-46218433 CCAGGCATGGAGCAGCAGCTTGG + Intronic
1175418569 20:58817271-58817293 CCAGGTCTGGGGCTTCCGCTGGG - Intergenic
1175642760 20:60644722-60644744 CCAGGTGTCTAGCTGCAGCAGGG - Intergenic
1176312295 21:5158583-5158605 CCAGGTCTTCAACTCCAGCTCGG - Intergenic
1176848183 21:13892500-13892522 CCATGGCTGGAGCTGGAGCTGGG + Intergenic
1177357930 21:20032170-20032192 CCAGGTCAACAGCTGTAGCTGGG + Intergenic
1177404229 21:20645409-20645431 CTGGGTCTGCAGCTGCAGCTGGG - Intergenic
1178564823 21:33673743-33673765 CCAGGTCCTGAGCTGGTGCTAGG - Intronic
1178864971 21:36319959-36319981 CCGAGTCTCGAGCTCCAGCTGGG + Intergenic
1179449783 21:41460508-41460530 CCAGGTCAGCAGCTGCCGCTGGG + Intergenic
1179844753 21:44103447-44103469 CCAGGTCTTCAACTCCAGCTCGG + Exonic
1179950379 21:44706094-44706116 CTAGGCCTCGATCTGCAGCTGGG - Intronic
1180922418 22:19527887-19527909 GCAGGCCGAGAGCAGCAGCTGGG + Intergenic
1181355516 22:22294042-22294064 CCAGGGCTAGGGCAGCAGCAGGG + Intergenic
1181421379 22:22801369-22801391 CCAGTTCTAGAGATGCAACTGGG + Intronic
1181429340 22:22868507-22868529 CCAGCTCTAGAGAAGCAACTGGG + Intronic
1181770291 22:25120217-25120239 CCTGGTCTCGGGCTGCACCTTGG + Intronic
1181798785 22:25330082-25330104 CCAGGTCCAGAACAGAAGCTAGG - Intergenic
1182509310 22:30807660-30807682 GCAGCTCTAGAGCTGGAGGTGGG - Intronic
1184130036 22:42512227-42512249 CCAGGCCCAGAGCTACAGCTGGG - Exonic
1184140215 22:42574045-42574067 CCAGGCCCAGAGCTACAGCTGGG - Exonic
1184913378 22:47550678-47550700 CAAGGTCAAGACCGGCAGCTGGG - Intergenic
1185343729 22:50302502-50302524 CCAGGTCTAGATGTGGAACTGGG + Intronic
950125361 3:10506850-10506872 CCAGGGATGGAGCGGCAGCTCGG - Intronic
950429292 3:12941664-12941686 GGAGGTCGAGTGCTGCAGCTTGG + Exonic
950439867 3:13004370-13004392 TCAGGTGTTGAGATGCAGCTGGG + Intronic
953748294 3:45591590-45591612 CCAGGTCTGCAGCCACAGCTGGG + Intronic
953880410 3:46688400-46688422 CCAGCCCTGGAGCTGCAGCAGGG + Intronic
954801007 3:53186807-53186829 CCTGGGCTAGAGCGGCAACTGGG + Intronic
957775981 3:84757411-84757433 CCAGGTCTGCAGCTGTGGCTGGG + Intergenic
958019752 3:87980957-87980979 CCAGGTCCACAGCTGTAGCTGGG + Intergenic
958678348 3:97294129-97294151 CCAGGTCTGGAGCCACAGCTGGG + Intronic
959476659 3:106820969-106820991 CCAGTTCTGGAGCTGCACCCAGG - Intergenic
960862680 3:122167955-122167977 GCAGGTCTAGAAATGCAGTTGGG + Intergenic
961823872 3:129588722-129588744 GCAGGTCCAGGGCTGCACCTGGG + Intronic
961831703 3:129626485-129626507 CCAGGGCTAGGGCTGGGGCTGGG + Intergenic
962334129 3:134510781-134510803 CCAGGGCCAGAACTGCAGCCAGG - Intronic
963074341 3:141332477-141332499 CCAAGTTTGGAGGTGCAGCTAGG - Intronic
964485914 3:157185203-157185225 GCAGGTCTAGTGATGCAGCAAGG - Intergenic
965061433 3:163789053-163789075 CTAGGTCTGGAGCCACAGCTGGG + Intergenic
965774096 3:172210079-172210101 CTGGGTCCAGAGCTGCAGCTGGG + Intronic
965813515 3:172614774-172614796 CCAGGTCCAGAGTGGCAGCAGGG + Intergenic
967648262 3:191952817-191952839 CAAGGTCCAGAGCAGCAGCGCGG + Intergenic
967935668 3:194725535-194725557 CCAGGTCAAGGGCTGCTGATAGG + Intergenic
969585079 4:8087000-8087022 CCAGGGCCAGTGCTGCACCTCGG + Intronic
969667773 4:8571865-8571887 CATGGTATGGAGCTGCAGCTGGG - Intronic
970365292 4:15352142-15352164 TGAGGTGTAAAGCTGCAGCTTGG - Intronic
970959526 4:21856571-21856593 CCAGGTCTGCAGCCACAGCTGGG - Intronic
972106360 4:35494019-35494041 CCAGGTCTGCAGCTGTGGCTGGG - Intergenic
976129571 4:81870531-81870553 CCAGGTCTGCAGCTGCGGCTGGG - Intronic
978248672 4:106604745-106604767 CCAGGTCCACAGTTGCAGCCAGG + Intergenic
979020481 4:115490353-115490375 GCAGGTCTAGATCTCCAGCAAGG - Intergenic
980450045 4:132958822-132958844 CTAGGTCCACAGCTGCAACTTGG - Intergenic
980744878 4:137000707-137000729 CCAGGTCTGCAGCCACAGCTGGG - Intergenic
980750179 4:137077414-137077436 CCAGGTCTGCAACTGCAGGTTGG + Intergenic
981741892 4:148011319-148011341 TGATGTCTAGAGCTTCAGCTGGG + Intronic
982668348 4:158292419-158292441 CCTGGTGTGGAGCTCCAGCTGGG + Intergenic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
983572253 4:169222994-169223016 CCTTGTGAAGAGCTGCAGCTGGG - Intronic
984526852 4:180867353-180867375 CCAGGTCTGAAGCTACAACTGGG + Intergenic
985145677 4:186892100-186892122 CCAGCTCTACAGCTGGAGCTTGG + Intergenic
985916048 5:2919899-2919921 CCAGGTCTAGAGCCACAGCTGGG - Intergenic
987598436 5:20033084-20033106 CCAGTTTTAGAGCTGCAGAGAGG - Intronic
987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG + Intergenic
988109942 5:26807445-26807467 CTAGGTCCAGAGCCGCAGCTGGG - Intergenic
988261070 5:28886724-28886746 CCATGACCAGAGCTGCACCTTGG - Intergenic
988738343 5:34044937-34044959 CCAGACCTGGAGCTGGAGCTGGG + Intronic
989537514 5:42581825-42581847 CCAGGTCTAGAGGCACAGATGGG - Intronic
989730560 5:44642293-44642315 CCAGATCTAGAGCTGCAGCTGGG + Intergenic
993703449 5:91144116-91144138 CCAGGTCTGCAGCTGCAGCTTGG + Intronic
994558168 5:101331115-101331137 GCAGGTGCAGAGCTGCAGGTGGG - Intergenic
994705980 5:103207047-103207069 CCTGGTCTAGGAATGCAGCTAGG + Intronic
994916110 5:105982407-105982429 TCCGATCTAGAGCTTCAGCTGGG - Intergenic
995630534 5:114127433-114127455 CCATGACTCGAGCTGCACCTTGG + Intergenic
995926926 5:117386003-117386025 CAAGGTCCAGAGCTGTGGCTGGG - Intergenic
996697734 5:126417447-126417469 CCAGGTCTGGTGCTTCAGCTGGG - Intronic
996853893 5:127983111-127983133 CGAGGTCTGGGGCTTCAGCTAGG + Intergenic
998040215 5:138946796-138946818 CAAGGTACAGAGCTGCTGCTTGG + Exonic
998424434 5:142014430-142014452 GCTGGTCTGGAGCTGCAGTTGGG - Intergenic
998480629 5:142459694-142459716 CCAGGTCCACAGCTGTGGCTGGG + Intergenic
998494708 5:142577947-142577969 CAAGGTCTTGAGCTGAAGGTAGG - Intergenic
1000621298 5:163489471-163489493 CCAGGACTAGAGCTGAAATTGGG + Intronic
1000854344 5:166379808-166379830 CCAGGTCCACAGCCACAGCTGGG + Intergenic
1001699568 5:173697186-173697208 ACAGGGCTAGAGTTGCAGGTAGG + Intergenic
1001756693 5:174175798-174175820 CCAGGCCTGGAGCTGCTGCAGGG - Intronic
1002642739 5:180638163-180638185 CCAGGTCTCTAGCTCCAGCCAGG + Intronic
1002678115 5:180935631-180935653 CTGGGTCTGGAGCTGCGGCTGGG + Intronic
1004304360 6:14487142-14487164 CCAGGTCTACAGCTGCAACTTGG - Intergenic
1005035846 6:21554321-21554343 CCAAGTCTATAGCTCTAGCTCGG - Intergenic
1005781830 6:29201141-29201163 CCGGGTCTGCCGCTGCAGCTTGG - Intergenic
1006143752 6:31946116-31946138 CTAGGTCTGGAGTTTCAGCTTGG + Exonic
1006660900 6:35643289-35643311 AAATGTCAAGAGCTGCAGCTAGG - Intronic
1007957187 6:45928948-45928970 CCAGGTCTTGATCTGCATCCAGG + Intronic
1009643203 6:66363226-66363248 TGAGGTCTGGAGCTGAAGCTGGG + Intergenic
1009684179 6:66935739-66935761 CCAGGTCCGGAGCTGCAGCTGGG - Intergenic
1009847007 6:69146518-69146540 CTAGGTCTGCAGCTGCAGCTGGG + Intronic
1010652154 6:78467851-78467873 CCAGATCTCCAGCTGCTGCTGGG - Intergenic
1010664383 6:78611191-78611213 CCAGGTCCTCAGCTGCAGATGGG - Intergenic
1012122283 6:95384023-95384045 CCAGGTCCACAGCCACAGCTTGG - Intergenic
1012270089 6:97198381-97198403 CCACGTCTGGAGCCTCAGCTAGG - Intronic
1012526321 6:100182335-100182357 TCAAGTCTGGAGCTGAAGCTAGG - Intergenic
1012709465 6:102581551-102581573 CCTGGTCCAGAGCTGCAGCTTGG - Intergenic
1015663578 6:135603062-135603084 CCAGGTCTACTGCTGTGGCTTGG - Intergenic
1015877818 6:137841903-137841925 GCAGGTCTAGATCTCCAGCAAGG + Intergenic
1016339781 6:143049925-143049947 CCAGGTCTGCAGCTGCAGGTCGG + Intergenic
1016877798 6:148881122-148881144 CAAGGTATAGAGCAGCAGCATGG + Intronic
1017054374 6:150424410-150424432 CTGGGTCTACAGCTGCAACTTGG - Intergenic
1017824500 6:158071505-158071527 GCAGGTCCCGAGCTGCTGCTGGG + Intronic
1018956313 6:168412737-168412759 CCAGGTCTTGAGCTTGAGCCTGG + Intergenic
1019674138 7:2301272-2301294 CCAGGTGTGGGGCTGCAGCTGGG - Intronic
1020130104 7:5554996-5555018 CCAGGGCTAGAGTCTCAGCTTGG + Intronic
1021343224 7:19489547-19489569 CCAGGTCCACAGCTGTGGCTGGG + Intergenic
1021677558 7:23096990-23097012 CCAGGTCTGGAGTTGTGGCTGGG - Intergenic
1023123494 7:36932957-36932979 CCAGGGCTGGTGCTGCAGCCAGG + Intronic
1024290715 7:47801575-47801597 CCATGACTATAGCTGCAGCTAGG - Intronic
1026527907 7:71171754-71171776 TCAGTCCTAGAGCTGCTGCTGGG + Intronic
1026867738 7:73833724-73833746 CCAGGCCCAGACCTACAGCTTGG + Intergenic
1027333858 7:77127322-77127344 TCAGATCTACAGCTGCAGTTTGG + Intronic
1027584822 7:80044879-80044901 CCATGGCTTGAGCTGCACCTTGG + Intergenic
1028136659 7:87230180-87230202 CCAGGTCCACAGCTGCAGCTGGG - Intergenic
1028378994 7:90176929-90176951 CCAGGTCCACAGCTGTGGCTTGG + Intronic
1028527509 7:91801786-91801808 CCAGGTCTGCAGCCGCAACTTGG + Intronic
1028816998 7:95157444-95157466 CCAGGTCTGCAGCTGCAATTTGG + Intronic
1030569557 7:111205743-111205765 TCAGCTCTAGAGCAGCAACTGGG - Intronic
1031859000 7:126957439-126957461 CCCAGTCTGGAGCTGCAGCTGGG - Intronic
1032658423 7:133955983-133956005 CCAGGTCCACAGCTCCAGTTTGG + Intronic
1033260362 7:139838829-139838851 CCAGGGCTGGAGATGGAGCTGGG + Intronic
1033936093 7:146587440-146587462 CTAGGTGTAGGGCTGCAGCTTGG + Intronic
1034132715 7:148735324-148735346 GCAGGTGCAGAGCTGCAGCAGGG - Intronic
1034210504 7:149358603-149358625 CTAGGTCTGCAGCTGCAGCTTGG + Intergenic
1034210526 7:149358694-149358716 CCAGGTCTGCAGCCACAGCTTGG + Intergenic
1034416817 7:150969720-150969742 CCAGGCCTTGAGCTCCAGGTGGG - Intronic
1034561259 7:151880821-151880843 CCAGGCCTGGAGCTGGGGCTGGG + Intergenic
1035520367 8:271290-271312 ACAGGCCTAGAGCTGGAGCTGGG - Intergenic
1036907521 8:12719979-12720001 CCAGGTCTGGAGCCATAGCTGGG - Intergenic
1040017398 8:42710766-42710788 CCAGGTAGGGAACTGCAGCTAGG + Intronic
1042624992 8:70748285-70748307 CCAGGTCTAGAGCTGCAGCTGGG - Intronic
1043414653 8:80034285-80034307 CTGGATCTGGAGCTGCAGCTGGG + Intronic
1044867890 8:96590306-96590328 ACAAGTCCAGAGCTGCAGCCTGG - Intronic
1045691191 8:104761743-104761765 CAAGGTCAAGGGCTGCAGCCTGG + Intronic
1048373726 8:133803417-133803439 CCAGCTCCAGAGCTGCTGGTGGG - Intergenic
1048409589 8:134158430-134158452 CCAGGTCTAGAGTTGAATCCTGG - Intergenic
1048548061 8:135405194-135405216 CTGGGTCTGCAGCTGCAGCTAGG + Intergenic
1048758300 8:137763776-137763798 CCAGGTCATGAACTGCTGCTAGG + Intergenic
1048819646 8:138369181-138369203 CCAGGTCTTGAGATCCTGCTAGG - Intronic
1050483858 9:6114134-6114156 CCAGGTCTGCAGCTGAAGTTTGG - Intergenic
1050937154 9:11413362-11413384 CCAGGTCTGCAGCTGTGGCTAGG - Intergenic
1052597022 9:30574575-30574597 CCAGGTCCAGAGCCACAGCTGGG - Intergenic
1052691349 9:31820565-31820587 CCAGCTCTGGAGCTGTGGCTGGG - Intergenic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054709664 9:68498714-68498736 CCAGGGCTGGAGCCTCAGCTAGG - Intronic
1056462067 9:86818118-86818140 CCAGGTCTGCAGCCACAGCTGGG - Intergenic
1056849459 9:90070137-90070159 CGATGTCTAGGGCTTCAGCTGGG + Intergenic
1057314687 9:93960719-93960741 CCAGGTCTCGAGCTGCGGCCTGG - Intergenic
1057838845 9:98468889-98468911 ACAGGTCTAGAGGAGCAGCATGG + Intronic
1057847706 9:98538395-98538417 TCAGATCTAGAGCTGCTGCTGGG - Intronic
1058639438 9:107068647-107068669 TAAGGTCTAGAACTGCAGGTAGG - Intergenic
1060896590 9:127222373-127222395 CCAGGCACAGAGCTGCAGTTGGG + Exonic
1062581661 9:137231653-137231675 CCAGGTCTAGATCTGCTGGGGGG - Exonic
1185935887 X:4257024-4257046 TCAGGTCCACAGCTGCAACTAGG - Intergenic
1186805758 X:13139130-13139152 CTGGGTCTAAAGCTGCAGTTTGG - Intergenic
1187871349 X:23767336-23767358 CCAGGTCTGCAGCTGTGGCTGGG + Intergenic
1188647765 X:32591770-32591792 CCAGGTCCGGAGCTGTGGCTGGG - Intronic
1188727878 X:33607425-33607447 CCAGGTCCAGAGCCACAGCTGGG + Intergenic
1190360662 X:49645371-49645393 CCAGGTCTGCAGCTGTGGCTTGG + Intergenic
1191016249 X:55813375-55813397 CCAGATCTCGAGCTGCAGCTGGG - Intergenic
1195125358 X:101803658-101803680 CCCAATCTAGAACTGCAGCTTGG + Intergenic
1197501249 X:127244508-127244530 CCAGGTCCTCAGCCGCAGCTTGG + Intergenic
1198189377 X:134287652-134287674 CCAGGTCTGCAGCTGCAGCTGGG - Intergenic
1198466275 X:136907372-136907394 CCAGGCCTAGTCCTGGAGCTTGG - Intergenic
1199494885 X:148441794-148441816 CCAGGGGTAGAGCTGCTGATGGG + Intergenic
1200115227 X:153767063-153767085 CACGGCCTCGAGCTGCAGCTCGG - Exonic
1201067526 Y:10112431-10112453 TCAGATCTCCAGCTGCAGCTGGG + Intergenic