ID: 1042624994

View in Genome Browser
Species Human (GRCh38)
Location 8:70748286-70748308
Sequence CCCAGGTCTAGAGCTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 5, 2: 18, 3: 41, 4: 318}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042624994_1042624999 -3 Left 1042624994 8:70748286-70748308 CCAGCTGCAGCTCTAGACCTGGG 0: 1
1: 5
2: 18
3: 41
4: 318
Right 1042624999 8:70748306-70748328 GGGCATCCCTGCACTCGCAGGGG No data
1042624994_1042624998 -4 Left 1042624994 8:70748286-70748308 CCAGCTGCAGCTCTAGACCTGGG 0: 1
1: 5
2: 18
3: 41
4: 318
Right 1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG No data
1042624994_1042624997 -5 Left 1042624994 8:70748286-70748308 CCAGCTGCAGCTCTAGACCTGGG 0: 1
1: 5
2: 18
3: 41
4: 318
Right 1042624997 8:70748304-70748326 CTGGGCATCCCTGCACTCGCAGG No data
1042624994_1042625001 3 Left 1042624994 8:70748286-70748308 CCAGCTGCAGCTCTAGACCTGGG 0: 1
1: 5
2: 18
3: 41
4: 318
Right 1042625001 8:70748312-70748334 CCCTGCACTCGCAGGGGCCCAGG No data
1042624994_1042625005 24 Left 1042624994 8:70748286-70748308 CCAGCTGCAGCTCTAGACCTGGG 0: 1
1: 5
2: 18
3: 41
4: 318
Right 1042625005 8:70748333-70748355 GGAAGCCCCCTTCCCCCCACAGG No data
1042624994_1042625007 29 Left 1042624994 8:70748286-70748308 CCAGCTGCAGCTCTAGACCTGGG 0: 1
1: 5
2: 18
3: 41
4: 318
Right 1042625007 8:70748338-70748360 CCCCCTTCCCCCCACAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042624994 Original CRISPR CCCAGGTCTAGAGCTGCAGC TGG (reversed) Intronic
901143663 1:7051547-7051569 GCCAGGTCTTGAGCTGCTTCAGG + Intronic
901436637 1:9250739-9250761 TCCCGGTCCAGAGCTGCTGCAGG + Intronic
902393589 1:16120086-16120108 CCCAGGCCCTGGGCTGCAGCTGG + Intergenic
902579142 1:17397291-17397313 CCCAGGTCTGGGGCTAGAGCTGG + Intronic
902876755 1:19344960-19344982 CCCAGGTCTGGGGGTGGAGCAGG + Intronic
903068591 1:20715447-20715469 GGCAGGGCCAGAGCTGCAGCTGG - Intronic
904314844 1:29653461-29653483 CCCAGGCCCAGAGCAGCTGCTGG + Intergenic
904732823 1:32607422-32607444 CCCAGGTCTGGAGCCGCAGCTGG + Intronic
905182063 1:36173417-36173439 CCCAGGACCAGCGCTGCTGCCGG - Exonic
905347100 1:37318670-37318692 GGCAGGTCCAGAGCTGCCGCTGG + Intergenic
905506292 1:38482167-38482189 CCCAGGGCTGGAGCAGGAGCAGG + Intergenic
906287682 1:44598244-44598266 CCCAGGTCATGAGCAGCAGCAGG + Intronic
906448369 1:45922690-45922712 CCTGGGTCTGAAGCTGCAGCAGG + Intronic
907487419 1:54787476-54787498 TCCAGGTCATGAGCTGCAGACGG + Intronic
907625174 1:56022518-56022540 CACAGGTCCAGAGGTGCAGGAGG - Intergenic
907985238 1:59524014-59524036 CCCAGGTCCAGAGCCGCAGCTGG - Intronic
910387964 1:86705077-86705099 CCCAGGCCTCTGGCTGCAGCAGG - Intronic
911288789 1:96029266-96029288 CTCAGGTCTGCAGCTGCAGCTGG + Intergenic
911434890 1:97844760-97844782 CCCAGGTCTGGAGCCACAGCTGG - Intronic
911475489 1:98367547-98367569 CCCAGGTCCAGAGCTGTGGCTGG + Intergenic
912548305 1:110466855-110466877 CCCAGGTGCAGGGCTGCAGGAGG - Intergenic
912956296 1:114155976-114155998 GCCAGGTCCGGAGCTGCTGCCGG - Intergenic
914392874 1:147237477-147237499 CCCAGGTCTGCAGCTGCAGCTGG + Intronic
915006660 1:152644578-152644600 CCCAGAGCTAGAGCTGCAGCAGG + Intergenic
915564458 1:156705993-156706015 CCCAGATCTTGAGCCGTAGCTGG + Intergenic
916030647 1:160874930-160874952 CCCAATTCTAAAGCTGCAGGTGG - Intergenic
918157894 1:181868166-181868188 TCCAGGTCTCAAGCTGCAGTTGG + Intergenic
919205829 1:194420803-194420825 GCCAGGTCTGCAGATGCAGCTGG + Intergenic
919729009 1:200901132-200901154 CCCAGGGGGAGAGCAGCAGCCGG - Exonic
919943556 1:202304476-202304498 ATCAGGTCCAGAGCTGGAGCGGG + Intronic
923328052 1:232898230-232898252 CCCAGGTCCACAGCTGCAGCTGG - Intergenic
923949527 1:238932489-238932511 CCCAGTTCTGGAGCTGGAGTTGG - Intergenic
924626705 1:245701836-245701858 CCCAGGTCCAGGGGTCCAGCAGG - Intronic
924672948 1:246147752-246147774 CCCAGGTCTGCAGCCGCAGCAGG - Intronic
1063609096 10:7547956-7547978 CCCAGATCCTGAGCTGGAGCTGG + Intergenic
1065471908 10:26090918-26090940 CCCTGATCCACAGCTGCAGCTGG - Intronic
1067239360 10:44477158-44477180 GCCTGGTCCAGGGCTGCAGCTGG + Intergenic
1067258797 10:44667679-44667701 CCCAGGTCTGGAGCCATAGCTGG + Intergenic
1067738247 10:48875954-48875976 CCCACCTCTGGAGCTGGAGCAGG - Intronic
1068046132 10:51888680-51888702 CCCACAGCTAGAGCTGCAGTGGG - Intronic
1068938324 10:62657495-62657517 CCTGGGTCCAGAGCTGCGGCTGG - Intronic
1069212413 10:65779021-65779043 CCCTGGTCCAGAGCTGCAGCTGG - Intergenic
1069373100 10:67767585-67767607 GCCAGGGCCAGAGCTGCAACTGG + Intergenic
1069952568 10:72029645-72029667 CTCTGGACTTGAGCTGCAGCTGG + Intergenic
1070401492 10:76056804-76056826 CCTGGGTCTGCAGCTGCAGCTGG + Intronic
1071819532 10:89265264-89265286 CCTAGGTCTGCAGCTACAGCTGG + Intronic
1073176832 10:101561911-101561933 CCCAGGCCCAAAGCTGCAGGTGG + Intergenic
1074715755 10:116217127-116217149 CCCAGGTCCAGACCTGCAGGTGG + Intronic
1074977653 10:118594563-118594585 CCCAGGCGTAGAGCTGGCGCTGG + Exonic
1075132193 10:119749217-119749239 CCCAGGTCTGGAGCCTCTGCTGG + Intronic
1075368516 10:121914845-121914867 CCCAGGTCCAGAACAACAGCAGG + Intronic
1075411515 10:122231954-122231976 CTCAGGGCTGGAGCAGCAGCCGG - Intronic
1075862677 10:125690671-125690693 CCCAGGTCCACAACTGGAGCAGG - Intergenic
1075923795 10:126234967-126234989 CCCAGGTCTGATGCTGCAGGTGG + Intronic
1076381814 10:130028663-130028685 CCCAGGGCCACAGCGGCAGCAGG - Intergenic
1077100314 11:819598-819620 CCCCGAGCTAGAGCCGCAGCGGG + Exonic
1077159768 11:1107434-1107456 CCCAGGTCAGGCCCTGCAGCAGG - Intergenic
1077282611 11:1752531-1752553 CCCAGGTCTGGAGCAGTAGCCGG - Intronic
1077370756 11:2180552-2180574 CCCAGGTCCTGAGCAGGAGCAGG + Intergenic
1078303219 11:10156036-10156058 CCCGGGTCCAGAGCTGCAGCTGG - Intronic
1078355492 11:10628997-10629019 CCCATCTCTTGAGCAGCAGCAGG - Intronic
1079381923 11:19945665-19945687 CCCTGCTCTAGAGCACCAGCTGG + Intronic
1079673937 11:23202193-23202215 CCCAGGTCCAGAGCTGTGTCTGG - Intergenic
1080333818 11:31174075-31174097 CCTGGGTCTGCAGCTGCAGCTGG - Intronic
1080333839 11:31174165-31174187 CCTGGGTCTGCAGCTGCAGCTGG - Intronic
1081044217 11:38251142-38251164 CCCGAGTCTGGAACTGCAGCTGG + Intergenic
1081620776 11:44618157-44618179 CCCAGGTGAAGTGCTGCGGCTGG + Exonic
1082687806 11:56260853-56260875 CCCAGGTCTGGAGCCACAGCTGG + Intergenic
1083691262 11:64410209-64410231 CCCAGGACGTGGGCTGCAGCTGG - Intergenic
1083915963 11:65744046-65744068 CTGGGGTCTGGAGCTGCAGCTGG - Intergenic
1084402642 11:68954008-68954030 CCCAGCACTGAAGCTGCAGCAGG + Intergenic
1085064693 11:73483310-73483332 CCCAGGTCTAGGGCTTTAGAAGG + Intronic
1085414569 11:76311561-76311583 CTCAGGTCCAGAGCTCCCGCAGG + Intergenic
1086947157 11:92854336-92854358 CCCAGGTCCAGAGCTGTGGCTGG + Intronic
1087339036 11:96878779-96878801 CCCAGGTCCAGAGCAGTGGCTGG + Intergenic
1087422339 11:97945321-97945343 CCTAGGTCTTGGGCTGCACCAGG + Intergenic
1088650958 11:111958036-111958058 CCCAGGTCTGCAGCTACAGCTGG - Intronic
1091916480 12:4274292-4274314 CCCAGGTTTAGGGCTCCGGCCGG - Intronic
1092079852 12:5706743-5706765 CCATGGTCTAGAGCAGCACCTGG + Intronic
1093018952 12:14185489-14185511 CCCAGATATGGGGCTGCAGCAGG + Intergenic
1093502523 12:19828441-19828463 CCCAGGTCTGGAGTTGTGGCTGG + Intergenic
1093581020 12:20784002-20784024 CCCAGGCCAACAGCTGCAGAGGG - Intergenic
1094525260 12:31227028-31227050 CCCAGCTCCAGGGCTGCGGCTGG + Intergenic
1095860925 12:46917317-46917339 CCCAGGCACAGAGCTGCTGCAGG + Intergenic
1097695629 12:62772638-62772660 CACAGATCTAGAGTTGCAGCTGG - Intronic
1098338602 12:69428583-69428605 CACATGTCTAGTGATGCAGCAGG + Intergenic
1098519724 12:71421364-71421386 ACCAGGTCCAGAGCTGCAGCTGG + Intronic
1099233899 12:80059202-80059224 GCCAGGTCTGAGGCTGCAGCTGG + Intergenic
1101678805 12:106944304-106944326 CCATGGTATGGAGCTGCAGCTGG - Intergenic
1101840433 12:108324034-108324056 CAGAGGTCTAGGGCTCCAGCAGG + Intronic
1101903143 12:108806560-108806582 GGGAGTTCTAGAGCTGCAGCGGG - Intronic
1102024578 12:109706970-109706992 CCCAGGTCTGGGGCTGCGGGAGG + Intergenic
1102026352 12:109715950-109715972 CCCTGGACTAGGGGTGCAGCAGG - Intronic
1104482899 12:129123951-129123973 TCCAGGTCTCCAGCTGCAGAAGG + Intronic
1105273104 13:18895660-18895682 CCCAGGTCTGCAGGAGCAGCAGG - Intergenic
1105278001 13:18947415-18947437 CCCAGGGCTAGTTCTGCAGTTGG - Intergenic
1105437831 13:20392045-20392067 CCCAGTCCTAGAGCTGCCCCGGG + Intergenic
1105443932 13:20436591-20436613 TCCAGGACTAGAGCTGCTGACGG - Intronic
1106999666 13:35527754-35527776 CCCAGGTCCAGAGCCACAGCTGG + Intronic
1107119570 13:36781638-36781660 CCCAGGGCTGGGGCTGGAGCTGG + Intergenic
1107744380 13:43489347-43489369 CCAGGGTTTACAGCTGCAGCTGG - Intronic
1107841027 13:44458598-44458620 CCCAGGTCTGGAGGTACGGCTGG - Intronic
1108017123 13:46087138-46087160 TCCAGGTCTGTAGCTGCAGCGGG + Intronic
1108023223 13:46150761-46150783 CCCAGGACTAGAGCAGCAGATGG + Intronic
1110670363 13:78169733-78169755 CCCGGGGCTGGAGCTGTAGCAGG + Intergenic
1111202942 13:84962502-84962524 CCCAGGTCTGGAGCCGCGGCTGG + Intergenic
1111347204 13:86974501-86974523 CCCTGGTCCAGAGCTGCTGCTGG - Intergenic
1111546277 13:89741214-89741236 CCCGGGTACAGAGCTGCGGCTGG - Intergenic
1112266795 13:97931845-97931867 CTCAGGTCAAGGGCTGCATCTGG + Intergenic
1112669807 13:101621929-101621951 CTCAGGTCAAGAGCTGAGGCTGG + Intronic
1114402534 14:22423046-22423068 CTCAGAAGTAGAGCTGCAGCAGG - Intergenic
1115059024 14:29168384-29168406 CCCTGGTCCAGAGCTGCAGCTGG - Intergenic
1116298123 14:43138728-43138750 TCCAGGTGAAGAGATGCAGCAGG + Intergenic
1117733891 14:58750794-58750816 CCCAGGTCCACAGCCACAGCTGG - Intergenic
1118893998 14:69930771-69930793 TCCAGGCCAAGAGCTGCATCAGG - Intronic
1119257279 14:73209136-73209158 CCCAGGTCTACAGCCACAGCTGG + Intronic
1119323818 14:73746792-73746814 CCCACCTGCAGAGCTGCAGCAGG - Intronic
1119770802 14:77219653-77219675 CCCAGCGCCCGAGCTGCAGCAGG + Intronic
1119916976 14:78411373-78411395 CCCAGGGCCTGTGCTGCAGCAGG - Intronic
1121408580 14:93734158-93734180 CCCAGGTCTTGGTCTGCAGATGG + Intronic
1121866526 14:97367401-97367423 CCCAGGCCTGGGGCTGCGGCTGG + Intergenic
1121922852 14:97899170-97899192 CCCAGGTCTGGAGATGCCTCTGG - Intergenic
1122251490 14:100443076-100443098 CCCAGGTTTCCACCTGCAGCCGG - Intronic
1122409090 14:101516996-101517018 CCTAGGCCCAGAGCCGCAGCAGG - Intergenic
1122876498 14:104668590-104668612 CCCAGGCAGAGAGCTACAGCCGG + Intergenic
1124362305 15:29046619-29046641 GCCAGGTCTAGAGCTGCAGGTGG - Intronic
1124439904 15:29678168-29678190 CCCAGGTCTCACTCTGCAGCAGG - Intergenic
1124635817 15:31364690-31364712 GCCAGAGCTAGAGCCGCAGCTGG - Intronic
1124641783 15:31400508-31400530 CCCAGGTCCAGAGCTGAAGGTGG + Intronic
1125433886 15:39625686-39625708 CCCAGCTCTACAGCTGGAGGGGG + Intronic
1125502273 15:40247136-40247158 CCCAGGTCTGAGGCTGGAGCAGG - Intronic
1125854985 15:42939927-42939949 CCCAGCAATAGAGCTTCAGCAGG + Intergenic
1126215120 15:46145966-46145988 CCTGGGTCTACAGCTGCAGCTGG - Intergenic
1127986516 15:64076476-64076498 CTCATGTCTATAGGTGCAGCAGG - Intronic
1128657777 15:69475069-69475091 TGCAGCTCTAGATCTGCAGCTGG - Intergenic
1129231486 15:74199511-74199533 CCCAGGTGTAAAGGTGGAGCGGG - Intronic
1131512146 15:93055388-93055410 CCCAGGTCCGGTGCTGCAGGCGG + Intronic
1132035803 15:98483167-98483189 CCCAGCTCTGGTGCTGCAGGTGG - Intronic
1132142451 15:99406932-99406954 CCTAGCTCCAGAGCAGCAGCTGG - Intergenic
1132459246 16:42251-42273 ACCAGCTCTACAGCCGCAGCAGG + Intergenic
1132524379 16:407097-407119 CCCAGGTCGAGGGCTCCAGTAGG - Intronic
1132661207 16:1062309-1062331 GCCAGGGCCGGAGCTGCAGCCGG - Intergenic
1132712235 16:1274152-1274174 CCCAGGTCCTGAGCTGAGGCTGG - Intergenic
1132978915 16:2724933-2724955 CCCCGGTCTGCAGCTACAGCTGG - Intergenic
1132992582 16:2804578-2804600 CTCAGGTGTAGAGCTGGAGAGGG - Intergenic
1133302640 16:4792150-4792172 GCCAGGCCAAGAGCTGGAGCAGG + Intronic
1133307660 16:4821002-4821024 CCCAGGTATACTGCTGCTGCTGG - Intronic
1137343792 16:47636451-47636473 CCTGGGTCTGGAGCTGCGGCTGG - Intronic
1137434979 16:48447617-48447639 CCCAGGTCTAGAGTCTCTGCTGG - Intronic
1139015397 16:62683928-62683950 CCCAGGCCTGGAGCTGTGGCTGG - Intergenic
1139463736 16:67142715-67142737 CCAGGGTCTGGAGCTGCAGCTGG + Intronic
1139488194 16:67271201-67271223 CCGAGGCCTTGAGCTACAGCCGG - Exonic
1139625958 16:68188366-68188388 CCCGGGTCAGCAGCTGCAGCTGG + Intronic
1140103389 16:71938094-71938116 CCCAGGTCTGCAGCTGTGGCTGG - Intronic
1141111989 16:81277391-81277413 CCCAGGACTTGAGCTGGAACTGG + Intronic
1142284275 16:89165407-89165429 CCCTGGACTATAGATGCAGCCGG + Intergenic
1143350779 17:6286486-6286508 CCCAGGTCTGGAGCTGAGGGAGG - Intergenic
1143499438 17:7330303-7330325 CCCTGCTCCAGAGCTGCGGCGGG - Intergenic
1143830282 17:9645621-9645643 CCCAGGTCCATGGCTGCCGCCGG - Exonic
1146209758 17:30932955-30932977 ACCAAGTCTTGAGCTGCACCAGG - Intronic
1146644041 17:34564568-34564590 TCCAGGTCTAGTGCTGCAGCAGG + Intergenic
1146953386 17:36921676-36921698 CCCAGGTCTGGAGGTGGATCTGG + Intergenic
1148955942 17:51353639-51353661 CCAAGGTCTAGACCTGGGGCAGG + Intergenic
1149169365 17:53791781-53791803 CCTGGGTCTGGAGCTGCAGCTGG - Intergenic
1149381681 17:56100718-56100740 CTCAGGTCTAAGGCTTCAGCTGG - Intergenic
1149664261 17:58354744-58354766 ACAAGGTCTGGAGCTGGAGCAGG + Exonic
1151045653 17:70917173-70917195 GCCAGGGCTGGAGCTGGAGCTGG - Intergenic
1151045928 17:70919478-70919500 GCCAGGGCTGGAGCTGGAGCTGG - Intergenic
1151847602 17:76668227-76668249 CCCAGGTCAAGACCTGCAGGAGG - Intergenic
1152087383 17:78228782-78228804 CCCAACTCTAGATGTGCAGCTGG - Intergenic
1152678991 17:81656077-81656099 CCCAGGGCTGGAGAAGCAGCTGG - Intronic
1152856721 17:82668760-82668782 CCCGCGTCTAGAGCTGCCCCAGG + Intronic
1153472984 18:5467911-5467933 CCCAAATCCACAGCTGCAGCTGG - Intronic
1153608059 18:6854767-6854789 CCCGGGTCCAGAGCTGCAGGTGG - Intronic
1154464868 18:14633222-14633244 CCCAGGTCTGCAGGAGCAGCAGG - Intergenic
1155215653 18:23641278-23641300 CCCAGAACCGGAGCTGCAGCTGG - Intronic
1156468380 18:37362239-37362261 CTCAGAGCTAGAGCTGGAGCTGG - Intronic
1157248412 18:46072710-46072732 CCCAGGGCCTGATCTGCAGCAGG - Intergenic
1157289588 18:46400134-46400156 ACAAGGCCTAGAGCTGGAGCTGG - Intronic
1157337716 18:46753834-46753856 CACTGGTCTAGAGCAGCAGGAGG + Intronic
1158448683 18:57543766-57543788 CACAGCTGTAGAGCTCCAGCTGG - Intergenic
1158774022 18:60555293-60555315 CCCAGGTCTGGAGCTGCAGCTGG - Intergenic
1159774373 18:72586037-72586059 CCCAGGTCTGCAGCTGCAGCTGG + Intronic
1159781749 18:72668115-72668137 CCCAGGCATAGAGCTGCTGTAGG + Intergenic
1160679387 19:405809-405831 CCCAGGACTGGAGGAGCAGCTGG - Exonic
1160952096 19:1672450-1672472 TCCAGGGACAGAGCTGCAGCGGG + Intergenic
1160986861 19:1843159-1843181 CCCGGGCCCAGAGCCGCAGCTGG + Intronic
1160986882 19:1843219-1843241 CCCGGGCCCAGAGCCGCAGCTGG + Intronic
1161234840 19:3192687-3192709 CTCAGGTCCAGAGCTGCGGCGGG + Intronic
1161653289 19:5498229-5498251 CCCAGGGCTGGGGCTGCACCTGG - Intergenic
1161660727 19:5544283-5544305 CCCAGGTGTACAGCCGCACCAGG + Intergenic
1161664621 19:5567940-5567962 CCCGGGGCCAGAGCTGGAGCCGG - Intergenic
1162066232 19:8126851-8126873 ACCAGGTCCTGAGCTGCAGGAGG + Intronic
1163975574 19:20848695-20848717 ACCAGGTCTAGAAATGCAACAGG + Intronic
1164015647 19:21254038-21254060 ACCAGTTCCACAGCTGCAGCAGG + Intronic
1164189587 19:22901855-22901877 CCCACGTCTAAGGCTCCAGCTGG + Intergenic
1164586410 19:29478846-29478868 GCCAGCCCCAGAGCTGCAGCAGG + Intergenic
1166360542 19:42251277-42251299 CCCAGGCCTGGAGCTTGAGCAGG + Intronic
1167110280 19:47456754-47456776 CCCACGTCTAGAGCAGCGCCTGG + Intronic
1167169640 19:47822560-47822582 CCCAGGTCTGTGGCTGCAACAGG + Intronic
1167306701 19:48713933-48713955 GTCAGGGCTGGAGCTGCAGCAGG + Exonic
1168701058 19:58439831-58439853 CCCAGGGCTAGCCCTGCCGCTGG + Exonic
926547114 2:14255540-14255562 CCCGGGTCCAGAGCTGTAGCTGG + Intergenic
926621530 2:15050635-15050657 CCCAGCTCTAGGGCTCCAGAGGG - Intergenic
927162606 2:20282108-20282130 CCCAGTTCTATCGGTGCAGCTGG - Intronic
927706020 2:25297031-25297053 CCCAGGGCCACAGCTGCAACAGG + Intronic
927824591 2:26299184-26299206 ACCAGGTCCACCGCTGCAGCAGG + Intergenic
928594740 2:32849006-32849028 CCCAGCTCTAGAGCTTCTGTGGG + Intergenic
929492311 2:42407727-42407749 CCCGGGTCTGAAGCTGCACCAGG - Intronic
929492328 2:42407799-42407821 CCCGGGTCTGAAGCTGCACCAGG - Intronic
929546377 2:42857451-42857473 GGCAGGCCTAGTGCTGCAGCTGG + Intergenic
929579199 2:43071011-43071033 CCCATGTCCAGATCTGGAGCCGG - Intergenic
929847251 2:45542385-45542407 CCCAGGTCCAGAGCTGTAGCTGG + Intronic
930435362 2:51334182-51334204 CCCAGATCTGGAACTGCAGTTGG + Intergenic
931881779 2:66576685-66576707 CCCGAGTCTGGAGCCGCAGCCGG + Intergenic
935436469 2:103040361-103040383 CCCAGGCATAGAACTGCTGCAGG - Intergenic
935667459 2:105525217-105525239 CCCAGGTCCAGAGCTGCAGCTGG - Intergenic
937041952 2:118829420-118829442 GCCAGGACCACAGCTGCAGCAGG + Intergenic
937377579 2:121348190-121348212 CCCAGGGCTGGGGCTACAGCAGG + Intronic
937737709 2:125312576-125312598 CCTGGGTCTAGAGCTGTGGCTGG - Intergenic
937950896 2:127387548-127387570 CCCAGGTCGGGGGCTGCCGCAGG + Intronic
938970071 2:136423762-136423784 ACCTGGGCTAGAGCTGAAGCCGG + Intergenic
940957047 2:159739155-159739177 CCCAAGTCTACAGCCACAGCTGG + Intronic
941433303 2:165437059-165437081 CCATGGTATGGAGCTGCAGCTGG - Intergenic
941998774 2:171626450-171626472 CCTGGGTCTGGAGCTGTAGCTGG - Intergenic
943226419 2:185184974-185184996 CCTGGGTCCAGAGCTGCAACTGG - Intergenic
945721195 2:213421114-213421136 CCCAGGTCCAGAGCTGCAGCTGG - Intronic
947666793 2:231911052-231911074 CCCAGCTCTGGGGCTGCAGTGGG - Intergenic
948230034 2:236342688-236342710 CCCAGCTCCAATGCTGCAGCAGG - Intronic
948548832 2:238753763-238753785 CCCAGGTCGGGAGGTCCAGCAGG + Intergenic
1168875005 20:1165245-1165267 GCTAGGTGGAGAGCTGCAGCAGG - Exonic
1170327756 20:15175909-15175931 CCCAGGTCTGGAGCCACAGTCGG - Intronic
1171141630 20:22748795-22748817 CTCAGGTCTGGAGGTGCAGGCGG - Intergenic
1171285909 20:23937991-23938013 CCCAGGTCTGGAGCTGCAGCTGG - Intergenic
1172630545 20:36375480-36375502 TCCAGGTCTAGTGCAGCACCTGG - Intronic
1172965353 20:38830241-38830263 CTCAGGGCTAGAGAGGCAGCAGG - Intronic
1173546697 20:43903335-43903357 GCCAGGTCCAGAACTGGAGCAGG - Intergenic
1175642762 20:60644723-60644745 GCCAGGTGTCTAGCTGCAGCAGG - Intergenic
1175823964 20:61926540-61926562 CTCAGGGCTTGAGCTGCGGCAGG - Intronic
1176060039 20:63168500-63168522 CCCAGGTCCTCAGGTGCAGCTGG + Intergenic
1176809668 21:13525161-13525183 CCCAGGTCTGCAGGAGCAGCAGG + Intergenic
1177357928 21:20032169-20032191 CCCAGGTCAACAGCTGTAGCTGG + Intergenic
1177404230 21:20645410-20645432 CCTGGGTCTGCAGCTGCAGCTGG - Intergenic
1178864969 21:36319958-36319980 CCCGAGTCTCGAGCTCCAGCTGG + Intergenic
1179044732 21:37833925-37833947 CCCAGGGCTAGAAATGCAGGTGG - Intronic
1179449781 21:41460507-41460529 CCCAGGTCAGCAGCTGCCGCTGG + Intergenic
1179631570 21:42681943-42681965 CCGTGGTCTGAAGCTGCAGCCGG + Intronic
1179841945 21:44082261-44082283 GCCAGGTCTACAGTTGCTGCTGG - Intronic
1180211486 21:46297592-46297614 CCCGGGTCAGGGGCTGCAGCCGG - Exonic
1180626036 22:17194194-17194216 CCGAGGTTGAGAGCTGCAGTGGG + Intronic
1181337603 22:22151952-22151974 CACAGGTCTAGTGCTGTTGCAGG + Intergenic
1181355514 22:22294041-22294063 GCCAGGGCTAGGGCAGCAGCAGG + Intergenic
1181421377 22:22801368-22801390 GCCAGTTCTAGAGATGCAACTGG + Intronic
1181652845 22:24270585-24270607 CTCAGGTCTTGGGCTGGAGCCGG - Intergenic
1182557348 22:31136509-31136531 CCCAGGTCCAGCTCTGCAGTTGG - Intronic
1182863233 22:33579568-33579590 CCCTGGGCTGGGGCTGCAGCAGG - Intronic
1183105416 22:35611787-35611809 CCGAGGTCTAAAGCTGGAGGTGG - Intronic
1183508026 22:38220197-38220219 CCCAGGTCTAGAGGTGTGGAGGG + Exonic
1183740316 22:39665255-39665277 CTCAGATCTACAGCAGCAGCAGG - Intronic
1183961591 22:41414569-41414591 CCCAGGTCTGGCGCTGTGGCAGG - Intergenic
1184130038 22:42512228-42512250 TCCAGGCCCAGAGCTACAGCTGG - Exonic
1184140217 22:42574046-42574068 TCCAGGCCCAGAGCTACAGCTGG - Exonic
1185235142 22:49708035-49708057 CCCTGGTATGGAGCTGCAGGTGG - Intergenic
1185343727 22:50302501-50302523 CCCAGGTCTAGATGTGGAACTGG + Intronic
950290434 3:11779738-11779760 CCCAGGTCTGGAGCTGGAAATGG - Intergenic
950439866 3:13004369-13004391 CTCAGGTGTTGAGATGCAGCTGG + Intronic
950576040 3:13832599-13832621 CAGAGGTATACAGCTGCAGCTGG - Intronic
953748292 3:45591589-45591611 CCCAGGTCTGCAGCCACAGCTGG + Intronic
953880408 3:46688399-46688421 GCCAGCCCTGGAGCTGCAGCAGG + Intronic
955969125 3:64419591-64419613 CCAGGGCCTAGAGCTGCACCAGG - Intronic
957775979 3:84757410-84757432 CCCAGGTCTGCAGCTGTGGCTGG + Intergenic
958019750 3:87980956-87980978 TCCAGGTCCACAGCTGTAGCTGG + Intergenic
958678346 3:97294128-97294150 CCCAGGTCTGGAGCCACAGCTGG + Intronic
961059622 3:123817478-123817500 CCCAGGCCTACAGCTACACCAGG + Intronic
962268873 3:133963408-133963430 CCAAGGTCTAGAGCTGGGGTAGG + Intronic
964414069 3:156429296-156429318 CCCAGGCCTAGATCTGCGGGCGG - Intronic
965061432 3:163789052-163789074 CCTAGGTCTGGAGCCACAGCTGG + Intergenic
965774095 3:172210078-172210100 CCTGGGTCCAGAGCTGCAGCTGG + Intronic
965813513 3:172614773-172614795 CCCAGGTCCAGAGTGGCAGCAGG + Intergenic
968350791 3:198050177-198050199 GCCATGGCTGGAGCTGCAGCTGG + Intergenic
968503857 4:963100-963122 CCCTGGTCCAGGGCAGCAGCAGG - Intronic
969081075 4:4618625-4618647 CTGATGTCTGGAGCTGCAGCTGG - Intergenic
969444147 4:7234593-7234615 CCCAGGACTGGAACTGAAGCTGG - Intronic
969667774 4:8571866-8571888 CCATGGTATGGAGCTGCAGCTGG - Intronic
970959528 4:21856572-21856594 CCCAGGTCTGCAGCCACAGCTGG - Intronic
973620624 4:52722256-52722278 TCCAGGTCCAGAGCAGGAGCAGG + Intergenic
975299608 4:72774767-72774789 CCCAGATCCAGAGCTGTGGCTGG - Intergenic
976129573 4:81870532-81870554 CCCAGGTCTGCAGCTGCGGCTGG - Intronic
976647249 4:87399492-87399514 CCCGGGTCCCCAGCTGCAGCTGG - Intergenic
980744880 4:137000708-137000730 CCCAGGTCTGCAGCCACAGCTGG - Intergenic
982357990 4:154490548-154490570 CCCATGCCTCGATCTGCAGCCGG + Intronic
982668346 4:158292418-158292440 CCCTGGTGTGGAGCTCCAGCTGG + Intergenic
982957601 4:161792020-161792042 CCTGGGTCCACAGCTGCAGCTGG - Intronic
984526850 4:180867352-180867374 CCCAGGTCTGAAGCTACAACTGG + Intergenic
985490103 5:174215-174237 GCCAGGGCTAGAGCTGGGGCTGG + Intronic
985916050 5:2919900-2919922 CCCAGGTCTAGAGCCACAGCTGG - Intergenic
986004585 5:3657341-3657363 CCTAGGTTTAGAGATTCAGCAGG + Intergenic
986384553 5:7218809-7218831 CACAGGTCTGGAGCTGCAAAAGG + Intergenic
987816088 5:22902139-22902161 TCTGGGTCCAGAGCTGCAGCTGG + Intergenic
988109943 5:26807446-26807468 CCTAGGTCCAGAGCCGCAGCTGG - Intergenic
988143058 5:27267419-27267441 CCCAGGTCACCAGCTGCAGAGGG - Intergenic
988218535 5:28310970-28310992 CCCAGGTCCAGAGCTGTGGCTGG - Intergenic
988738341 5:34044936-34044958 CCCAGACCTGGAGCTGGAGCTGG + Intronic
989537516 5:42581826-42581848 CCCAGGTCTAGAGGCACAGATGG - Intronic
989730558 5:44642292-44642314 CCCAGATCTAGAGCTGCAGCTGG + Intergenic
991297863 5:65100905-65100927 CCCATGTCTAGCGCTGTGGCTGG - Intergenic
994916111 5:105982408-105982430 CTCCGATCTAGAGCTTCAGCTGG - Intergenic
996697736 5:126417448-126417470 CCCAGGTCTGGTGCTTCAGCTGG - Intronic
998005701 5:138655508-138655530 CCCAGGTCTAGTGATGTAGAAGG + Intronic
998480627 5:142459693-142459715 CCCAGGTCCACAGCTGTGGCTGG + Intergenic
998761127 5:145433500-145433522 CCCAGGTGAAGAGCAGCAGCTGG - Intergenic
1000854342 5:166379807-166379829 CCCAGGTCCACAGCCACAGCTGG + Intergenic
1001756695 5:174175799-174175821 CCCAGGCCTGGAGCTGCTGCAGG - Intronic
1002422004 5:179153765-179153787 CCAAGGACAAGAGATGCAGCAGG - Intronic
1002597507 5:180334015-180334037 CCCAGGTCAAGTGCAGAAGCTGG - Intronic
1002678114 5:180935630-180935652 CCTGGGTCTGGAGCTGCGGCTGG + Intronic
1003215192 6:4103057-4103079 TCTAAGTCTAGAGCTGCAGATGG + Intronic
1003561583 6:7185062-7185084 CCCAGTTCTACAACTGCAGTCGG - Intronic
1006891477 6:37433106-37433128 CCCAGGTTGAGAGGTGGAGCGGG + Intergenic
1009351008 6:62678567-62678589 CCCTGGTCTTGAGCTCCAGTAGG + Intergenic
1009643202 6:66363225-66363247 CTGAGGTCTGGAGCTGAAGCTGG + Intergenic
1009684181 6:66935740-66935762 CCCAGGTCCGGAGCTGCAGCTGG - Intergenic
1009847006 6:69146517-69146539 CCTAGGTCTGCAGCTGCAGCTGG + Intronic
1010652156 6:78467852-78467874 CCCAGATCTCCAGCTGCTGCTGG - Intergenic
1010664385 6:78611192-78611214 CCCAGGTCCTCAGCTGCAGATGG - Intergenic
1012847975 6:104413595-104413617 TGCACGTTTAGAGCTGCAGCAGG + Intergenic
1017556787 6:155580252-155580274 CCCCAGACTAGAGATGCAGCAGG + Intergenic
1019674140 7:2301273-2301295 ACCAGGTGTGGGGCTGCAGCTGG - Intronic
1020586663 7:10078596-10078618 CCTAGGTCCACAGCTGCAGCTGG - Intergenic
1021455944 7:20829866-20829888 CCCATGCCTGCAGCTGCAGCGGG + Intergenic
1021677560 7:23096991-23097013 CCCAGGTCTGGAGTTGTGGCTGG - Intergenic
1022071943 7:26924720-26924742 CCTAAGTCTAGATCTGCTGCAGG + Intronic
1023994305 7:45149788-45149810 CTCAGGCCTGGGGCTGCAGCTGG - Intergenic
1024814819 7:53256625-53256647 CACAGGCCTAGAGGTGTAGCAGG + Intergenic
1027788917 7:82614747-82614769 CCCAGGATGACAGCTGCAGCAGG + Intergenic
1028136661 7:87230181-87230203 CCCAGGTCCACAGCTGCAGCTGG - Intergenic
1028630499 7:92928646-92928668 CACAGGGCTAGTTCTGCAGCAGG - Intergenic
1029252134 7:99244526-99244548 CCCAGGTCAGGAGCTGCTGGGGG + Intergenic
1030569558 7:111205744-111205766 CTCAGCTCTAGAGCAGCAACTGG - Intronic
1031859002 7:126957440-126957462 GCCCAGTCTGGAGCTGCAGCTGG - Intronic
1032842986 7:135728544-135728566 CCAAGGTCTAGATCAGCAGGTGG - Intronic
1033209186 7:139447874-139447896 ACTAGATTTAGAGCTGCAGCAGG - Intergenic
1034100358 7:148445447-148445469 CCCAGGTCAGCAGCTGCAGAGGG - Intergenic
1034132716 7:148735325-148735347 GGCAGGTGCAGAGCTGCAGCAGG - Intronic
1034541598 7:151762017-151762039 CCCAGGCCATGAGCTGCAGTTGG - Intronic
1035520368 8:271291-271313 CACAGGCCTAGAGCTGGAGCTGG - Intergenic
1035828555 8:2669821-2669843 CCCACGCCTTGAGCGGCAGCAGG - Intergenic
1036907523 8:12719980-12720002 CCCAGGTCTGGAGCCATAGCTGG - Intergenic
1041662352 8:60412717-60412739 ACCAGGTCTACAGCAGCACCAGG - Intergenic
1042624994 8:70748286-70748308 CCCAGGTCTAGAGCTGCAGCTGG - Intronic
1043414652 8:80034284-80034306 CCTGGATCTGGAGCTGCAGCTGG + Intronic
1043833866 8:85022395-85022417 CCCAAGTCTCGGGCTGCTGCTGG + Intergenic
1045628400 8:104085284-104085306 CCCAAGCCTACAGCTACAGCAGG - Intronic
1046083504 8:109402402-109402424 TCCATGTCTAGAGCCTCAGCAGG + Intronic
1046740189 8:117819623-117819645 CTCTGGTCTGGAGCTGGAGCAGG + Intronic
1047371959 8:124263486-124263508 CCCAGGTCCTGACCAGCAGCAGG + Intergenic
1048260086 8:132937963-132937985 CCCGGGTCTAGAACGGCTGCCGG - Intronic
1048328973 8:133459507-133459529 CCCAGCTCTAGGGCAGCAGTGGG + Exonic
1048373728 8:133803418-133803440 CCCAGCTCCAGAGCTGCTGGTGG - Intergenic
1049482522 8:142833583-142833605 CCGAGGCTTAGAGTTGCAGCAGG - Intergenic
1049483190 8:142837438-142837460 CCGAGGCTTAGAGTTGCAGCAGG + Intronic
1049646015 8:143735917-143735939 CCCAAGACAAGAGCTGCTGCTGG + Intergenic
1049683334 8:143929497-143929519 CACAGGCCTCCAGCTGCAGCCGG + Exonic
1049943306 9:569539-569561 CCAAAGTCTAGGGCTGCATCTGG - Intronic
1052597024 9:30574576-30574598 CCCAGGTCCAGAGCCACAGCTGG - Intergenic
1052691351 9:31820566-31820588 CCCAGCTCTGGAGCTGTGGCTGG - Intergenic
1054805307 9:69391666-69391688 CGCAGCTCTGGAGGTGCAGCAGG - Exonic
1056295804 9:85192000-85192022 CCCAGTGCTAGAACGGCAGCTGG - Intergenic
1056462069 9:86818119-86818141 CCCAGGTCTGCAGCCACAGCTGG - Intergenic
1057847707 9:98538396-98538418 ATCAGATCTAGAGCTGCTGCTGG - Intronic
1061499097 9:130992087-130992109 CCCAGGCCTAGAGGAGGAGCAGG + Intergenic
1062201121 9:135303236-135303258 CCCCAGGCTAGAGCTGCAGAAGG - Intergenic
1062581663 9:137231654-137231676 CCCAGGTCTAGATCTGCTGGGGG - Exonic
1188647767 X:32591771-32591793 CCCAGGTCCGGAGCTGTGGCTGG - Intronic
1188727876 X:33607424-33607446 CCCAGGTCCAGAGCCACAGCTGG + Intergenic
1191016251 X:55813376-55813398 CCCAGATCTCGAGCTGCAGCTGG - Intergenic
1191105836 X:56771657-56771679 TCCAGGCCTAGTGCTGCAGAGGG - Intergenic
1191106829 X:56777059-56777081 TCCAGGCCTAGTGCTGCAGAGGG - Intergenic
1198189379 X:134287653-134287675 CCCAGGTCTGCAGCTGCAGCTGG - Intergenic
1200213483 X:154357140-154357162 TCCCTGCCTAGAGCTGCAGCTGG + Intronic
1200495422 Y:3877140-3877162 CCACAGTATAGAGCTGCAGCAGG - Intergenic
1201067525 Y:10112430-10112452 CTCAGATCTCCAGCTGCAGCTGG + Intergenic
1201357434 Y:13112350-13112372 ACCAGGTCCATGGCTGCAGCAGG + Intergenic