ID: 1042624998

View in Genome Browser
Species Human (GRCh38)
Location 8:70748305-70748327
Sequence TGGGCATCCCTGCACTCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042624992_1042624998 -3 Left 1042624992 8:70748285-70748307 CCCAGCTGCAGCTCTAGACCTGG 0: 1
1: 5
2: 17
3: 54
4: 304
Right 1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG No data
1042624990_1042624998 25 Left 1042624990 8:70748257-70748279 CCTGTGCTCCTGGGCGCAGATGT 0: 1
1: 0
2: 1
3: 36
4: 232
Right 1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG No data
1042624991_1042624998 17 Left 1042624991 8:70748265-70748287 CCTGGGCGCAGATGTAGCTGCCC 0: 1
1: 0
2: 14
3: 101
4: 361
Right 1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG No data
1042624994_1042624998 -4 Left 1042624994 8:70748286-70748308 CCAGCTGCAGCTCTAGACCTGGG 0: 1
1: 5
2: 18
3: 41
4: 318
Right 1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042624998 Original CRISPR TGGGCATCCCTGCACTCGCA GGG Intronic
No off target data available for this crispr