ID: 1042629968

View in Genome Browser
Species Human (GRCh38)
Location 8:70805670-70805692
Sequence TCACCCAGTAAGGATGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042629968_1042629971 -9 Left 1042629968 8:70805670-70805692 CCTGACTCATCCTTACTGGGTGA No data
Right 1042629971 8:70805684-70805706 ACTGGGTGAGGCTTCCCTGCAGG No data
1042629968_1042629976 22 Left 1042629968 8:70805670-70805692 CCTGACTCATCCTTACTGGGTGA No data
Right 1042629976 8:70805715-70805737 TAACTCCAGCCAGAGGCTCCCGG 0: 3
1: 62
2: 94
3: 99
4: 369
1042629968_1042629974 15 Left 1042629968 8:70805670-70805692 CCTGACTCATCCTTACTGGGTGA No data
Right 1042629974 8:70805708-70805730 ACTCCAATAACTCCAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042629968 Original CRISPR TCACCCAGTAAGGATGAGTC AGG (reversed) Intergenic
No off target data available for this crispr