ID: 1042629971

View in Genome Browser
Species Human (GRCh38)
Location 8:70805684-70805706
Sequence ACTGGGTGAGGCTTCCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042629964_1042629971 7 Left 1042629964 8:70805654-70805676 CCTCTTCAGGCGTGACCCTGACT No data
Right 1042629971 8:70805684-70805706 ACTGGGTGAGGCTTCCCTGCAGG No data
1042629968_1042629971 -9 Left 1042629968 8:70805670-70805692 CCTGACTCATCCTTACTGGGTGA No data
Right 1042629971 8:70805684-70805706 ACTGGGTGAGGCTTCCCTGCAGG No data
1042629967_1042629971 -8 Left 1042629967 8:70805669-70805691 CCCTGACTCATCCTTACTGGGTG No data
Right 1042629971 8:70805684-70805706 ACTGGGTGAGGCTTCCCTGCAGG No data
1042629963_1042629971 15 Left 1042629963 8:70805646-70805668 CCAGAGTGCCTCTTCAGGCGTGA No data
Right 1042629971 8:70805684-70805706 ACTGGGTGAGGCTTCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042629971 Original CRISPR ACTGGGTGAGGCTTCCCTGC AGG Intergenic
No off target data available for this crispr