ID: 1042629974

View in Genome Browser
Species Human (GRCh38)
Location 8:70805708-70805730
Sequence ACTCCAATAACTCCAGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042629967_1042629974 16 Left 1042629967 8:70805669-70805691 CCCTGACTCATCCTTACTGGGTG No data
Right 1042629974 8:70805708-70805730 ACTCCAATAACTCCAGCCAGAGG No data
1042629970_1042629974 5 Left 1042629970 8:70805680-70805702 CCTTACTGGGTGAGGCTTCCCTG No data
Right 1042629974 8:70805708-70805730 ACTCCAATAACTCCAGCCAGAGG No data
1042629968_1042629974 15 Left 1042629968 8:70805670-70805692 CCTGACTCATCCTTACTGGGTGA No data
Right 1042629974 8:70805708-70805730 ACTCCAATAACTCCAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042629974 Original CRISPR ACTCCAATAACTCCAGCCAG AGG Intergenic
No off target data available for this crispr