ID: 1042629976

View in Genome Browser
Species Human (GRCh38)
Location 8:70805715-70805737
Sequence TAACTCCAGCCAGAGGCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 3, 1: 62, 2: 94, 3: 99, 4: 369}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042629967_1042629976 23 Left 1042629967 8:70805669-70805691 CCCTGACTCATCCTTACTGGGTG No data
Right 1042629976 8:70805715-70805737 TAACTCCAGCCAGAGGCTCCCGG 0: 3
1: 62
2: 94
3: 99
4: 369
1042629973_1042629976 -7 Left 1042629973 8:70805699-70805721 CCTGCAGGAACTCCAATAACTCC No data
Right 1042629976 8:70805715-70805737 TAACTCCAGCCAGAGGCTCCCGG 0: 3
1: 62
2: 94
3: 99
4: 369
1042629968_1042629976 22 Left 1042629968 8:70805670-70805692 CCTGACTCATCCTTACTGGGTGA No data
Right 1042629976 8:70805715-70805737 TAACTCCAGCCAGAGGCTCCCGG 0: 3
1: 62
2: 94
3: 99
4: 369
1042629970_1042629976 12 Left 1042629970 8:70805680-70805702 CCTTACTGGGTGAGGCTTCCCTG No data
Right 1042629976 8:70805715-70805737 TAACTCCAGCCAGAGGCTCCCGG 0: 3
1: 62
2: 94
3: 99
4: 369
1042629972_1042629976 -6 Left 1042629972 8:70805698-70805720 CCCTGCAGGAACTCCAATAACTC No data
Right 1042629976 8:70805715-70805737 TAACTCCAGCCAGAGGCTCCCGG 0: 3
1: 62
2: 94
3: 99
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042629976 Original CRISPR TAACTCCAGCCAGAGGCTCC CGG Intergenic
900587928 1:3442360-3442382 TCAGGCCACCCAGAGGCTCCAGG + Intergenic
901253137 1:7796905-7796927 TAACTCCAGCCCAAAACTCCTGG - Intronic
901470439 1:9452283-9452305 TCACTGCAGCCTGAGCCTCCTGG - Intergenic
902101822 1:13996664-13996686 TAACTCCAGCCAAAGGCTCAGGG + Intergenic
902187019 1:14733241-14733263 TAACTCCAAGCACAGGCTGCCGG - Intronic
903392128 1:22972012-22972034 TCACTCCAGGCAGAGGCCTCTGG + Intergenic
903987826 1:27241964-27241986 TCACTGCAGCCTCAGGCTCCTGG + Intronic
905294578 1:36946210-36946232 TGCCTCCAGCCCCAGGCTCCAGG - Intronic
906343637 1:45002048-45002070 TTACTCCAGCCTGGGCCTCCTGG - Intergenic
908930520 1:69312179-69312201 TAATTCCAGCCAGAGGCTCACGG - Intergenic
909053298 1:70793810-70793832 TTACTCCACCAAGAGCCTCCTGG + Intergenic
909303111 1:74038274-74038296 CAACTCCAGCCAGGGGCTCAGGG + Intronic
909697546 1:78484315-78484337 AAATTCCAACCAGAGGCTCGGGG + Intronic
910367030 1:86476982-86477004 TCACTCCAGCCTCAGCCTCCCGG + Intronic
910518311 1:88088396-88088418 TAACTCCAGCCATAGGCTCAGGG - Intergenic
911508576 1:98784274-98784296 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
913541145 1:119822302-119822324 TAACTCCAACCAGAGGCTCAGGG - Intergenic
914400630 1:147316768-147316790 CAACTCCAGCCAGAGGCTCCGGG + Intergenic
914404636 1:147358427-147358449 CAACTCCAGACAGGGGCTCAGGG + Intergenic
915013048 1:152707922-152707944 AAATTTCAGCCAGAGGCTCTGGG - Intergenic
915396997 1:155592626-155592648 TCACTCCAACCTGTGGCTCCCGG + Intergenic
917024853 1:170631041-170631063 TAACTCCAGCCAGAGCCTCAGGG - Intergenic
917059159 1:171017857-171017879 CTACTCCAGCCAGGGGCTCAGGG + Intronic
917060541 1:171032956-171032978 TAACTCCAGCCAGGGGCTCAGGG - Intronic
917062572 1:171056451-171056473 CAACTCTAACCAGAGGCTCAGGG + Intronic
917356419 1:174131142-174131164 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
917531702 1:175841810-175841832 CTACTCCTGCCTGAGGCTCCTGG + Intergenic
917582349 1:176391763-176391785 AAACTCCAGCCAGAGGCTCAAGG - Intergenic
917922308 1:179760661-179760683 CAAATGCAGCCAGAGGCTCCAGG + Intronic
918156245 1:181849555-181849577 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
918168753 1:181975272-181975294 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
918344119 1:183591217-183591239 TGTCACCAGCCAGAGGTTCCTGG + Intronic
918425640 1:184407043-184407065 TTACTGCAGCCTCAGGCTCCTGG + Intronic
918697297 1:187560333-187560355 CAACTCCAGCCAGGGCCTCAGGG - Intergenic
918802237 1:188986669-188986691 TAACTCCAGCCTGAGGCTCAGGG - Intergenic
921736393 1:218633470-218633492 TAGCTCCAGCCAGAGGCTCAAGG - Intergenic
921791931 1:219300051-219300073 TAACTGCACCCATAGTCTCCTGG + Intergenic
923751790 1:236753633-236753655 CTCCTCCAGCCAGAGGCTCTAGG - Intronic
923896397 1:238275204-238275226 CAACTCCAGCCAGTGGATGCAGG - Intergenic
924779280 1:247131740-247131762 TAACTCCAGCCAGATGCTCAGGG + Intronic
1066084960 10:31967360-31967382 TTACTGCAGCCACAGTCTCCTGG + Intergenic
1066393390 10:34996855-34996877 TCACTGCAGCCTCAGGCTCCTGG - Intergenic
1067207648 10:44233500-44233522 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1071059084 10:81548579-81548601 TAACTCCAGCCAGAGGCTTAGGG + Intergenic
1071071320 10:81697361-81697383 TAACAACAGCCAGAGGCTCAGGG + Intergenic
1071134550 10:82438231-82438253 TAACTCCAGCCAGAGGCTCAGGG - Intronic
1073446213 10:103582128-103582150 GATGTCCAGCCAGAGCCTCCAGG - Intronic
1074003373 10:109393924-109393946 TAATTCCAGCCAGAAGCTCAGGG + Intergenic
1074611860 10:115029353-115029375 TCACTGCAGCCTCAGGCTCCTGG + Intergenic
1075161099 10:120025315-120025337 GAACTCCAGCCAGAGACCCAGGG + Intergenic
1075172356 10:120127668-120127690 TAACTCCAGCCAGAGGCTCAAGG - Intergenic
1075397005 10:122134674-122134696 TGGCTACAGCCAGAGGCCCCTGG - Intronic
1075534410 10:123257867-123257889 TTCCACCAGGCAGAGGCTCCTGG - Intergenic
1075565128 10:123497687-123497709 TGTCTCCAGTGAGAGGCTCCAGG - Intergenic
1076065019 10:127441852-127441874 CCTCTCCAGCCAGAGCCTCCAGG + Intronic
1076185145 10:128440826-128440848 CAACTCCAGCCAGGGGCTCAGGG + Intergenic
1076651687 10:131994014-131994036 GCACTCCCTCCAGAGGCTCCAGG + Intergenic
1077510112 11:2955129-2955151 TCACTCCAGCCTCAAGCTCCTGG + Intronic
1078691258 11:13582768-13582790 CAACTCCAGCCAGGGGCTCAGGG + Intergenic
1079417376 11:20252185-20252207 GTACTCCATCTAGAGGCTCCAGG + Intergenic
1079481852 11:20889817-20889839 TAACTCCAGCCGGAGACTCAGGG + Intronic
1079935236 11:26608625-26608647 TAACTCCAGCCAGGGGCTCAGGG - Intronic
1080130873 11:28792986-28793008 CAACTCCAGCCAGAGACTTAGGG - Intergenic
1080164870 11:29224641-29224663 TAACTCCAGCCAGAAGCTCAGGG - Intergenic
1081092270 11:38887192-38887214 TGACTGCAGCCTGAAGCTCCTGG + Intergenic
1081340129 11:41917756-41917778 CAACTCCAGCCAGGGTCTCAGGG - Intergenic
1081454916 11:43212239-43212261 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1082947392 11:58774416-58774438 TGTCTCAAGCCAGAGGCTACCGG + Intergenic
1083096290 11:60254606-60254628 TCACTCCAGCCTGCAGCTCCAGG - Intergenic
1083397712 11:62402680-62402702 AAGCACCAGACAGAGGCTCCTGG + Intergenic
1085026734 11:73240696-73240718 TAGCTCCAGTCTGTGGCTCCTGG + Intergenic
1085066318 11:73498828-73498850 TAACTCCAGCCAGAGGCTCAGGG + Intronic
1085084083 11:73655383-73655405 TCACTCCAGGTGGAGGCTCCAGG + Intronic
1086301540 11:85431628-85431650 CAACTCCAACCAGGGGCTCAGGG + Intronic
1086513851 11:87589408-87589430 TAATTCCAGCCATAGGCTCATGG + Intergenic
1086566812 11:88236530-88236552 GGACTCCAGCCAGAGGCCACAGG - Intergenic
1086771670 11:90774833-90774855 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1088004864 11:104927518-104927540 CAACTCCAGCTAGAGGCTCAGGG + Intergenic
1088084426 11:105960295-105960317 TAACTCCAGCCAGAGGCTCAGGG - Intronic
1088167592 11:106956964-106956986 TAACTCCAGCTAGAGGCTCGGGG - Intronic
1088383372 11:109221385-109221407 CAACTCCGGCCAGGGGCTCAGGG - Intergenic
1089261981 11:117229770-117229792 TAATTCCAGCCAGAGGCAGGTGG + Exonic
1089582293 11:119489061-119489083 ACACTCCAGCCAGAGCCACCAGG - Intergenic
1090362301 11:126182143-126182165 TAGCTTGAGCCAGTGGCTCCAGG - Intergenic
1090734439 11:129598783-129598805 CAACTCCAGCCAGGGACTCAGGG + Intergenic
1091402982 12:192074-192096 TCACTCCACACACAGGCTCCTGG - Intronic
1091583695 12:1804059-1804081 TTACTCCAGCTGGAGGCACCAGG - Intronic
1091808475 12:3375100-3375122 TAGCTCCACCCAGAGAGTCCAGG - Intergenic
1091888708 12:4035423-4035445 TAACTCCAGACACAGTCTCATGG + Intergenic
1092443151 12:8527376-8527398 AAACTCCAGCCAGAGGCTCGGGG - Intergenic
1093303321 12:17479568-17479590 CAACTCCAGCCAGGGGTTCAGGG + Intergenic
1093383326 12:18521432-18521454 CAACTCCAGCCAGGGGCTTGGGG - Intronic
1093413649 12:18895913-18895935 CAACTCCAGCCAGGGGCTCAGGG - Intergenic
1093497522 12:19775391-19775413 GGAATCCAGCCAGAGCCTCCTGG - Intergenic
1093522522 12:20067214-20067236 TAACTCCCACCAGAGGCTCAGGG + Intergenic
1094054579 12:26256160-26256182 TAACTCTAGCCAGAGGCTCAGGG + Intronic
1094275348 12:28668876-28668898 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
1094380692 12:29840258-29840280 TAACTCCAGTCCCTGGCTCCTGG - Intergenic
1094789073 12:33889404-33889426 TTGCTCCAGCAAGACGCTCCAGG - Intergenic
1095320369 12:40819365-40819387 TAAGTCCAGCCAGAGGCTCAGGG - Intronic
1095532230 12:43202140-43202162 TATCTCCAGGCAGTGGCTTCAGG + Intergenic
1095867609 12:46989866-46989888 AGACTCCACCCAAAGGCTCCTGG + Intergenic
1095938724 12:47711960-47711982 CAGCTCCAGGCAGAGGGTCCGGG - Intronic
1097529508 12:60780850-60780872 CAACTCCAGCCAGGAGCTCAGGG - Intergenic
1097748972 12:63331056-63331078 TAGCTCCAGGCAGAGGCTCAGGG + Intergenic
1098439650 12:70504413-70504435 CAATTCCATCCAGAGGCTCAAGG - Intergenic
1099286759 12:80722466-80722488 TAACTTCTGCCTGAGCCTCCTGG - Intergenic
1099502659 12:83432687-83432709 CAACTCCAGCCAGGGGCTCAGGG - Intergenic
1099684300 12:85865884-85865906 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1100028136 12:90153624-90153646 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
1101066559 12:101027676-101027698 TAACTCCAGCCAGAGACTCAGGG + Intronic
1102069223 12:110003575-110003597 GGACTCCAGCAAGAGGCTGCTGG - Intronic
1102840825 12:116119218-116119240 TAACCCCTACCAGATGCTCCTGG + Intronic
1103285483 12:119797693-119797715 TACATCCAGCCAAAGGCTCTTGG - Intronic
1104820290 12:131673108-131673130 TCACTCCTGTCAGGGGCTCCCGG + Intergenic
1104820308 12:131673186-131673208 TCACTCCTGTCAGGGGCTCCTGG + Intergenic
1105295474 13:19085373-19085395 TGACTCCAGCCATAGGCTGCTGG + Intergenic
1106029833 13:25990078-25990100 TTTCTCCTGCCAGAGGCTCCTGG - Intronic
1106614108 13:31310610-31310632 CCACTCCAGCCCGTGGCTCCTGG - Intronic
1106676603 13:31966249-31966271 TTACTGCAGCCACAAGCTCCTGG + Intergenic
1106890106 13:34235912-34235934 TAACTCCAACCAGAAGCTGAGGG - Intergenic
1108113433 13:47102344-47102366 CAACTCCAGCCATGGGCTCAGGG + Intergenic
1108144688 13:47464047-47464069 CAACTCCAGCCAGAGTCTCAGGG + Intergenic
1108815623 13:54286996-54287018 CAACTCCAGCCAGGTGCTCAGGG - Intergenic
1109553336 13:63935736-63935758 TAACTCCAGCCAGAGTCTCAAGG - Intergenic
1110567120 13:76967973-76967995 CAACTCCAGCCAGGGGCTCAGGG - Intergenic
1110790472 13:79581866-79581888 CAACTCCAGCCAGAGGCTCAGGG - Intergenic
1110836909 13:80093775-80093797 GAACTCCAGCCGGGGGCTCAGGG - Intergenic
1111045200 13:82805522-82805544 CAACTCCAGCCAGGGACTCAGGG + Intergenic
1111092208 13:83462253-83462275 CAACTCCAGCCAGAGGTTCAGGG + Intergenic
1111200353 13:84927947-84927969 CAACTCCAGCCGGAGGCTCAGGG + Intergenic
1111305678 13:86409826-86409848 CAACTCCAGCCAGGGGCTGAGGG + Intergenic
1113120838 13:106922316-106922338 TCACTCAAGCCAGAGGCTTAAGG - Intergenic
1113917115 13:113881031-113881053 TCATTCCAGCCAGAGCCTCCAGG - Intergenic
1114705990 14:24726971-24726993 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
1115710949 14:36050049-36050071 TCACTGCAGCCTGGGGCTCCTGG - Intergenic
1115928812 14:38467662-38467684 AAACTCCAGCCAGGGGCTCAGGG - Intergenic
1116560902 14:46377284-46377306 TAACTCCAGCTAGAGGCTCAGGG - Intergenic
1116977435 14:51131619-51131641 TAATCCCAGCCAGAGGCTCAGGG + Intergenic
1117519347 14:56534774-56534796 TAACTCAAGACAGGAGCTCCCGG + Intronic
1118478915 14:66144123-66144145 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
1118530700 14:66702106-66702128 AAACTCCAGCCAGAGGCTCAGGG + Intronic
1120307102 14:82784636-82784658 TCACTGCAGCCAGAAACTCCTGG - Intergenic
1120365375 14:83561710-83561732 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
1120516736 14:85479948-85479970 TAACTCCTACCAGATGCTGCAGG - Intergenic
1120799133 14:88669552-88669574 CAACTCCAGCCAGAGGTTTGTGG + Intronic
1121245677 14:92459484-92459506 TTCCTCAAGCCAGAGGCTCTAGG + Intronic
1121249912 14:92491836-92491858 CAGTTCCAGCCAGAGGCTCTAGG + Intronic
1121706814 14:96002422-96002444 TAACTCCAGCCAGGGGCTTAGGG + Intergenic
1121717843 14:96088880-96088902 AAACTGCAGCCAGAAGCACCCGG - Exonic
1123115092 14:105890957-105890979 CAACTCCAGCCAGAGGCAATGGG + Intergenic
1202904429 14_GL000194v1_random:60119-60141 TCACTCCAGCCACAGGAGCCGGG + Intergenic
1123502620 15:20903600-20903622 TGACTCCAGCCCCTGGCTCCTGG + Intergenic
1123559868 15:21477267-21477289 TGACTCCAGCCCCTGGCTCCTGG + Intergenic
1123596105 15:21914566-21914588 TGACTCCAGCCCCTGGCTCCTGG + Intergenic
1124660759 15:31549059-31549081 TCACTCCAGCCTGTGTCTCCCGG - Intronic
1126284570 15:46996492-46996514 CAACTCCAGTCAGAGGCTCAGGG - Intergenic
1126552979 15:49953392-49953414 TAACTCCAGCCAGAGACTTAGGG - Intronic
1127042367 15:54991036-54991058 CAACTCCAGCCAAGGGCTCAGGG + Intergenic
1127666230 15:61149650-61149672 GAACTCCAGCCAGGAGCTCCAGG + Intronic
1127825238 15:62697180-62697202 TCACTGCAGCCTCAGGCTCCTGG + Intronic
1127857315 15:62963122-62963144 TTACTCCATCCTCAGGCTCCAGG + Intergenic
1127973930 15:63983450-63983472 AAACTCCAGCCACAGGCCCCAGG - Intronic
1129263037 15:74379600-74379622 TAACTGCAGCCTCTGGCTCCCGG + Intergenic
1130215729 15:81967116-81967138 TAACTTCAGCCTGAAACTCCTGG - Intergenic
1131089554 15:89612473-89612495 TAGCACCAGCCAGCTGCTCCTGG + Intronic
1132405801 15:101541350-101541372 TAAGACCATCCAGATGCTCCTGG + Intergenic
1202968212 15_KI270727v1_random:204429-204451 TGACTCCAGCCCCTGGCTCCTGG + Intergenic
1132775545 16:1591732-1591754 TCACTCCAGCCTGAGGCCCCCGG - Intronic
1133081872 16:3328107-3328129 AAACTCCAGACAGAGGATCAAGG - Intergenic
1133104132 16:3495650-3495672 TGACCCCAGCCAGAGGGACCAGG - Intergenic
1133943742 16:10331502-10331524 TTACTGCAGCCTCAGGCTCCTGG - Intronic
1134601221 16:15535274-15535296 TCACTCCAGCCTTAGACTCCTGG - Intronic
1135488504 16:22886833-22886855 TCACTGCAGCCTGAAGCTCCTGG + Intronic
1135700933 16:24631931-24631953 TCACTGCAGCCACAGCCTCCTGG + Intergenic
1135733567 16:24913542-24913564 TGACCCCAGCCAGAGGCAACAGG - Intergenic
1136645286 16:31608650-31608672 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
1136659970 16:31749141-31749163 TAACTCCAGCCAGAGGTTCAGGG - Intronic
1136669200 16:31840191-31840213 TCACTGCAACCTGAGGCTCCAGG + Intergenic
1137433201 16:48434922-48434944 TAACACCAGGCAGAGCCTTCAGG + Intronic
1137624257 16:49897675-49897697 TTTCTCCAGCCAGAGCTTCCAGG + Intergenic
1138319780 16:56102227-56102249 TGACGCCAGCCAGCTGCTCCAGG + Intergenic
1138363296 16:56451355-56451377 TTCCTGCCGCCAGAGGCTCCGGG - Exonic
1138572257 16:57883479-57883501 TCACTGCAGCCAGAAACTCCTGG + Exonic
1139229792 16:65272637-65272659 TAATTCCTGCCATAGGCTCAGGG + Intergenic
1140384488 16:74522756-74522778 TCACTGCAGCCTGAAGCTCCTGG + Intronic
1140977193 16:80071539-80071561 TAGATCCAGCCAGGGGTTCCTGG - Intergenic
1141130863 16:81435677-81435699 AAACTCCATCCAGGGACTCCAGG - Intergenic
1142408730 16:89905323-89905345 CCACTCCAGCCCGAGGCACCCGG - Intronic
1142911597 17:3097984-3098006 CAACTTCAGCCAGGGGCTCAGGG + Intergenic
1144772113 17:17765714-17765736 GAACCCCAGCCCGAGGCCCCAGG - Intronic
1145388971 17:22440478-22440500 CATCTCCAGCCATAAGCTCCAGG - Intergenic
1146229133 17:31093421-31093443 TCACTCCAGCCTCAGACTCCTGG - Intergenic
1146307666 17:31743043-31743065 TAACTCCACCCAGAGGTCCATGG + Intergenic
1146558802 17:33850450-33850472 TAATTGCAGCCAGAGGCTTAAGG - Intronic
1146794623 17:35772660-35772682 AAACTGCAGCCAGAGTCTTCAGG + Intronic
1149174467 17:53853195-53853217 TAACTCCAGCCAGAGGGTCAGGG + Intergenic
1149229684 17:54518825-54518847 TAACTCCAGTCAGAGGCTGAGGG - Intergenic
1149242139 17:54663180-54663202 CAATTCCAGCCAGAGGCTCAGGG - Intergenic
1149377921 17:56064413-56064435 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1149988233 17:61364631-61364653 TCACTGCAGCCACAGCCTCCTGG - Intronic
1150196489 17:63304767-63304789 CAACTCCAGCCAGGGACTCAGGG - Intronic
1150679091 17:67270046-67270068 TCACTGCAGCCTGAAGCTCCTGG + Intergenic
1151354944 17:73552887-73552909 GAGCGCCAGCCAGAGGCTCAGGG - Intronic
1151480342 17:74366851-74366873 TCAGTCCAGCCAGAGCCACCAGG - Intergenic
1151720107 17:75850198-75850220 TTTCTCCAGGCACAGGCTCCAGG - Intronic
1152245845 17:79184181-79184203 GAAATCCAACCAGAGCCTCCAGG + Intronic
1152302679 17:79504512-79504534 GAGCTCCCTCCAGAGGCTCCAGG + Intronic
1152350250 17:79780189-79780211 CAAGTCCAGCCAGGGGATCCAGG - Intronic
1153125356 18:1784513-1784535 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
1155847819 18:30731387-30731409 CCACTCCAGCCAGAGGCTCAGGG + Intergenic
1156529979 18:37805928-37805950 CAACTCCAGCCAGGGGCTCATGG - Intergenic
1156664602 18:39390228-39390250 CAACTCCAGTCAGGGGCTCAAGG + Intergenic
1156778499 18:40822099-40822121 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
1158105626 18:53882477-53882499 TAACTCCCGTCAGGGGCTCAGGG - Intergenic
1158729156 18:60003652-60003674 CAACTCCAGCCACAGGCTCAGGG - Intergenic
1158983042 18:62784016-62784038 TAACTCCAGACCCAGGCTCATGG + Intronic
1160073920 18:75653775-75653797 TAAGGCCAGACAAAGGCTCCTGG + Intergenic
1160128645 18:76204425-76204447 TCACTCCACCCAGAAGCCCCGGG + Intergenic
1160800021 19:963471-963493 CATCTGAAGCCAGAGGCTCCTGG + Intronic
1162384941 19:10355215-10355237 TCACTGCAGCCTGAGACTCCTGG - Intronic
1163603033 19:18260020-18260042 TAGCATCAGCCAAAGGCTCCTGG + Intronic
1163644762 19:18482863-18482885 TCACTGCAGCCACAGTCTCCTGG + Intronic
1163886108 19:19966270-19966292 CAGCTCCAGCCAGGGGCTCAGGG - Intergenic
1163888359 19:19989208-19989230 CAGCTCCAGCCAGGGGCTCAGGG + Intergenic
1163949643 19:20571842-20571864 CATCTCCAGCCAGGGGCTCAGGG - Intronic
1163968434 19:20770061-20770083 CATCTCCAGCCAGGGGCTCAGGG + Intronic
1164134924 19:22405932-22405954 CAACTCCAGCCAGGGGCTCAGGG + Intronic
1164163840 19:22650600-22650622 CAACTCCAGCCAGGGGCTCAGGG - Intronic
1165492090 19:36129684-36129706 TCACTGCAGCCTCAGGCTCCTGG + Intergenic
1165683378 19:37796635-37796657 TCACTGCAGCCTGAGACTCCTGG - Intronic
1166949942 19:46420325-46420347 GAGCTCCTTCCAGAGGCTCCAGG - Intergenic
1167219350 19:48187864-48187886 TTACTGCAGCCTGAAGCTCCTGG - Intronic
1167476193 19:49702696-49702718 GAACTCCAGACTGAGGATCCTGG + Intronic
925433166 2:3814725-3814747 TAACTCCAGTCAGAGGCTCAGGG - Intronic
925447478 2:3940567-3940589 GATCTCCAGCCAGAGTCTCAGGG - Intergenic
928237501 2:29557398-29557420 TAATTCCAGCCAGATTCTCAGGG + Intronic
928300804 2:30122302-30122324 CAACTCCAGCCAAATGCTACAGG + Intergenic
928803727 2:35125646-35125668 TAATTCCAGCCAGAGGCTCAGGG + Intergenic
929405549 2:41637351-41637373 CAACTCCAGCCAAGGGCTCAGGG + Intergenic
930168499 2:48227948-48227970 TAACTGTAGACAGATGCTCCTGG - Intergenic
930545794 2:52765958-52765980 TAACCCCAGCCGGAGTCTCAGGG + Intergenic
930581469 2:53217138-53217160 CAACTCCAGCCAGGGGCTCAGGG - Intergenic
930970264 2:57386318-57386340 TTACTCCAGACTGGGGCTCCTGG + Intergenic
932013366 2:68000149-68000171 CATCTCCAGTCACAGGCTCCTGG - Intergenic
932013490 2:68000914-68000936 TAACTCCAGCCAGAGGTTCAGGG + Intergenic
932756610 2:74414231-74414253 TTACTACTGCCAGAGGCTCAGGG + Exonic
932826759 2:74948172-74948194 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
933129513 2:78655272-78655294 CAACTCCAGCCAGGGGCTCAAGG + Intergenic
933237563 2:79882392-79882414 TAACTCCAGCCAGAGACTCAGGG - Intronic
934479095 2:94618634-94618656 CAACTCCAGCCAGAGGTTTATGG - Intergenic
935166530 2:100574076-100574098 TCACTCCAGCCTCAGCCTCCCGG + Intronic
935234154 2:101124066-101124088 TAGATTCAGCAAGAGGCTCCTGG + Intronic
936849066 2:116873896-116873918 TAACTCCAGCCAAAGGCTCAGGG - Intergenic
937087277 2:119179781-119179803 TTATTCCTGCCAGAGACTCCAGG + Intergenic
937893939 2:126963297-126963319 CACCTACAGCCAGAGGCTCAGGG - Intergenic
937931528 2:127208816-127208838 CAATTCCAGTCAGAGGCTCGGGG + Intronic
938136801 2:128765784-128765806 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
938397872 2:130964010-130964032 GAGCTCCAGCCACAGGCTCGGGG - Intronic
939109743 2:137992524-137992546 TAACACCAGCCAGAGGCTCAGGG + Intronic
939192437 2:138931993-138932015 TAAATCCAGCCAGAGGCTCAGGG + Intergenic
939808993 2:146808328-146808350 AAACTCCAGCCAGAGGCTCACGG + Intergenic
940094795 2:149962492-149962514 TAACTCCAGCCAGGGGCTCAGGG - Intergenic
940273365 2:151915159-151915181 TAACTTCAGCCAGAGGCTTAGGG - Intronic
940410757 2:153360681-153360703 CAACTCCAGCCAGGGGCTCAGGG + Intergenic
940592614 2:155748698-155748720 CAACTCCAGCCAGGGGCTCAGGG + Intergenic
940615864 2:156047898-156047920 CAACTCCAGCCAGGGGCTCAAGG + Intergenic
941088525 2:161147005-161147027 CAACTCCAGCCAGGGACTCAGGG - Intronic
941694352 2:168534911-168534933 TAACTCCAGCCAGAGGCTCAGGG - Intronic
942057370 2:172197037-172197059 AAACCACAGCCAGAGGCTGCGGG - Intergenic
942216060 2:173720062-173720084 ACACTCTGGCCAGAGGCTCCGGG + Intergenic
942503531 2:176617497-176617519 TCACTGCAGCCTGAGACTCCTGG - Intergenic
942924097 2:181411542-181411564 TAACTTCAGCCAGAGTCTCAGGG + Intergenic
943250723 2:185518604-185518626 CAACTCCAGCCAGGGCCTCAGGG - Intergenic
943302797 2:186224156-186224178 TGACTCCAGGCCGTGGCTCCTGG + Intergenic
944297956 2:198089001-198089023 GAATTGCACCCAGAGGCTCCAGG - Exonic
944385137 2:199155271-199155293 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
944713293 2:202355104-202355126 TTACTGCAGCCTGAAGCTCCTGG + Intergenic
945156259 2:206842161-206842183 TCACTGCAGCCTCAGGCTCCTGG + Intergenic
946428997 2:219614712-219614734 TAACCCCACCCAGAGGGTCAGGG - Intronic
946546475 2:220749548-220749570 TAGCTCCAACCAGAGGCTCAAGG + Intergenic
947480072 2:230491347-230491369 TAACTCCAGCCAGAGGCTCAGGG - Intronic
948065323 2:235074448-235074470 TCACTGCAGCCATAGTCTCCTGG + Intergenic
948268089 2:236653113-236653135 TATATCCAGCCAGAGGAACCTGG - Intergenic
948452358 2:238084031-238084053 TTACTCCAGCCAGATGCTACAGG + Intronic
948556965 2:238818828-238818850 TGACTCCACCAAAAGGCTCCTGG + Intergenic
948715100 2:239856095-239856117 TGGAACCAGCCAGAGGCTCCTGG - Intergenic
1168933504 20:1644250-1644272 CAACTCCAGCCTGGGGCTCAGGG - Intronic
1169695745 20:8385211-8385233 CAACTCCAGCCAGAGGCTCAGGG - Intronic
1170496626 20:16931098-16931120 CAACTCCAGCCAGGGGCTCAGGG + Intergenic
1170563563 20:17579506-17579528 TCACTGCAGCCTGAAGCTCCTGG - Intronic
1170613659 20:17933113-17933135 TGAGGCCAGCCAGAGGCTGCGGG - Intergenic
1170808835 20:19657753-19657775 TGCCCCCAGCCAGAGGCTACAGG + Intronic
1172936893 20:38626839-38626861 TAACACCAACCAGACTCTCCGGG - Intronic
1173411781 20:42817834-42817856 TAACTCCAGCTAGAGGCTCAAGG + Intronic
1173646456 20:44636154-44636176 CAGCTCCACCCAGAGGCCCCTGG - Intronic
1173946769 20:46957693-46957715 ATATTCCATCCAGAGGCTCCAGG - Intronic
1174973574 20:55305690-55305712 TGACTCCAGCCAGGAGCTCAGGG + Intergenic
1175771913 20:61629307-61629329 TGACTCCAGCCAGAGTCCCTGGG + Intronic
1175894031 20:62328165-62328187 TTCCTCTAGCCAGAGGGTCCTGG - Intronic
1175963344 20:62648064-62648086 TGCCCCCAGCCGGAGGCTCCAGG + Intronic
1176623798 21:9074886-9074908 TCACTCCAGCCACAGGAGCCGGG + Intergenic
1177511355 21:22091720-22091742 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1177878909 21:26669269-26669291 TAATTCCAGCCAGAGGCTCAGGG - Intergenic
1177956565 21:27606079-27606101 CAACTCCAGCCAGGGTCTCAGGG - Intergenic
1178485962 21:33020299-33020321 TGACGCCAGAGAGAGGCTCCCGG - Intergenic
1178845746 21:36172676-36172698 GAGCTCCAGGCTGAGGCTCCAGG - Intronic
1179783525 21:43717547-43717569 CAAGTCCAGCAAAAGGCTCCAGG - Intergenic
1181082628 22:20424939-20424961 AGCCTCCAGCCAGAGGCACCAGG + Exonic
1181440203 22:22931776-22931798 TAACTCCAGCCACAGGGGCCTGG - Intergenic
1182938913 22:34255120-34255142 TAACTCCAGTCAGAGGCTCAGGG - Intergenic
1183113189 22:35668457-35668479 TAACCCCATTCAGAGGCCCCTGG - Intergenic
1183190515 22:36319511-36319533 TATTTCCAGCGAGAGGCCCCGGG + Intronic
1183518032 22:38279000-38279022 TGACTCCACCCACTGGCTCCAGG - Intergenic
1184256143 22:43288247-43288269 TCACTCCACCCAGATGCCCCAGG - Intronic
1185176405 22:49329743-49329765 CAAGTCCAGCCAGTGGATCCAGG + Intergenic
1185301515 22:50083615-50083637 TCCCTCCAGGCAGGGGCTCCAGG + Intronic
949119913 3:373285-373307 TAACTCCAGCCAGAGGCTCAGGG - Intronic
949592760 3:5510776-5510798 CAACTCTAGCCAGGGGCTCAGGG + Intergenic
950027296 3:9828978-9829000 CAACTCCATCCAGAAGCACCTGG + Exonic
950878939 3:16305600-16305622 TAACTCCAGCCAGAGTGGCTTGG + Exonic
951951448 3:28203163-28203185 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
952251949 3:31664214-31664236 CACCTCCCGCCAGAGGTTCCTGG + Exonic
952503765 3:33989144-33989166 CAACTCTAGCCAGAGGCTCAGGG - Intergenic
953322509 3:41984710-41984732 TCACTCCAGCCTCAGTCTCCTGG + Intergenic
953454113 3:43028795-43028817 TCACTTCAGCCAGGGCCTCCAGG - Intronic
953878140 3:46678097-46678119 CAACTCCAGTCAGAGACTCTTGG - Intronic
954770115 3:52959457-52959479 TATCCCCAGCCAGACTCTCCAGG + Intronic
955246756 3:57231731-57231753 TCACTGCAGCCACAGACTCCTGG - Intronic
955415997 3:58691530-58691552 TCACTGCAGCCTCAGGCTCCTGG + Intergenic
955832101 3:63015565-63015587 CAACTCCAGCCACGGGCTCAAGG - Intergenic
957268842 3:78003117-78003139 TAACTCCAGCCAGGAGCTCAGGG - Intergenic
957394762 3:79622647-79622669 TAACTCCAGCCAGAGGCTCAGGG + Intronic
957584317 3:82114560-82114582 CAACTCCACCCAGAGGCTCAGGG - Intergenic
957630064 3:82707083-82707105 CAACTCCAGCCAGAGGCTCAGGG - Intergenic
958503727 3:94946577-94946599 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
958522219 3:95204501-95204523 CAACTCCAGCCAGAGGCTCAGGG - Intergenic
958656461 3:97009292-97009314 TAACTCCAGCCAGAGGATCAGGG - Intronic
958871683 3:99566663-99566685 AAACTCCACCAAAAGGCTCCTGG - Intergenic
959418347 3:106104233-106104255 TAACTCCAGCCAGAAGCTCAAGG - Intergenic
959452733 3:106523325-106523347 TAACTCCAGCCAGAGGCTTAGGG + Intergenic
960233471 3:115255094-115255116 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
960413759 3:117359185-117359207 TAACTCCAGCCAGGGGCTCATGG + Intergenic
960565354 3:119126335-119126357 TAACTCCAGCCAGAGGCTCAGGG + Intronic
960760774 3:121072249-121072271 TGCCTCAAGCCAGAGGCTACTGG - Intronic
961221956 3:125208121-125208143 TGCCTCCAGACAGAGGCCCCTGG + Intronic
961383358 3:126510041-126510063 TCACTCCAGCCAGTACCTCCGGG - Intronic
962193649 3:133337069-133337091 TGACTCCAGCCCCTGGCTCCTGG + Intronic
962691963 3:137907763-137907785 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
962789448 3:138797876-138797898 TCACTGCAGCCTGAGCCTCCTGG - Intronic
962809669 3:138949711-138949733 TATCTCCAGCCCGAAGCCCCTGG - Intronic
963043983 3:141089148-141089170 CAACCCAAGCCAGAGGCTACTGG + Intronic
963400440 3:144790990-144791012 CAACTCCAGCCAGAGGTTCAGGG - Intergenic
963461224 3:145617166-145617188 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
964007742 3:151851961-151851983 CAACTCCAGCCAGGGGTTCTGGG - Intergenic
964831240 3:160886168-160886190 CAACTCCAGCCAGAGGCTCAGGG + Intronic
966539613 3:181075043-181075065 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
966798018 3:183734301-183734323 AAACTCAAGCAATAGGCTCCAGG - Intronic
967241749 3:187446366-187446388 GGACTCCAGCTTGAGGCTCCTGG - Intergenic
967735516 3:192947858-192947880 TCACTACAGCCTGGGGCTCCTGG + Intergenic
968295822 3:197575852-197575874 TAACTCCTCCCTGAGTCTCCAGG + Intergenic
968316915 3:197732693-197732715 TCACTCCAGCCAGATGCTCTGGG - Intronic
969078959 4:4603391-4603413 ACACTCCCTCCAGAGGCTCCGGG - Intergenic
969728604 4:8940132-8940154 TGACTACAGCGGGAGGCTCCCGG - Intergenic
970155121 4:13133789-13133811 TAACTCCAGCCAGAAGCTCAGGG + Intergenic
970287969 4:14539462-14539484 AAACTCCAGCCAGAGGCTCAGGG + Intergenic
970494319 4:16609662-16609684 TAACTCCAGCCAGAGGCTCAGGG + Intronic
970952722 4:21775645-21775667 TAACTCCAGCCAGAGGCTCAGGG - Intronic
971818594 4:31522512-31522534 TATCTCCAGCCAGCTGCTCAAGG - Intergenic
971853196 4:32010502-32010524 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
972249800 4:37287604-37287626 CAACTCTAGCCAGAGACTCAGGG + Intronic
973018685 4:45172659-45172681 CAACTCCAGCCAGGGGCTCAGGG - Intergenic
973089203 4:46111104-46111126 GAACTCCACCAAAAGGCTCCTGG + Intronic
973584692 4:52378018-52378040 TAACTCCAGCCAAAGACTCAGGG + Intergenic
973723630 4:53750677-53750699 TGCCTCCAGCCCGAGGTTCCAGG + Intronic
974271493 4:59656398-59656420 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
974499719 4:62684292-62684314 GAACTCCAGCCAGGGGCTTAGGG + Intergenic
974867874 4:67603016-67603038 TAACTCCAGGCCCTGGCTCCTGG - Intronic
975232752 4:71954147-71954169 TAACTCCGTCTAGAGGATCCTGG - Intergenic
975353980 4:73378201-73378223 TCACTGCAGCCTCAGGCTCCTGG + Intergenic
975647660 4:76561479-76561501 TACCTCCAGGCAGAGACTCAAGG - Intronic
976538187 4:86242528-86242550 TAATTCCAGCCAGAGGCTCAGGG - Intronic
976807406 4:89063458-89063480 TAACTCCAGCCAGAGGCTGAGGG - Intronic
977060746 4:92254715-92254737 CAACTCCAGCCAGAGGCTTAGGG - Intergenic
977268800 4:94889102-94889124 GATCCCCAGCAAGAGGCTCCTGG - Intronic
977462006 4:97337320-97337342 CAACTCTAGCCAGGGGCTCAGGG + Intronic
978206176 4:106083396-106083418 TAACTCCAGCCAGAGGCTCAGGG + Intronic
978656848 4:111075004-111075026 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
979293698 4:119006000-119006022 GAGCTCCAGCCAGAGGCACCTGG + Intronic
979583864 4:122391545-122391567 TAACTCCAGCTAGAGGCTCAGGG - Intronic
979596575 4:122541521-122541543 TAACTTCAGACAGCGGTTCCAGG - Intergenic
979654429 4:123175836-123175858 GCCCTCCAGCCAGAGACTCCTGG + Intronic
979735067 4:124073034-124073056 AAACTCCAGCCAGAGGCTCAGGG + Intergenic
979775455 4:124583524-124583546 TAACTCCAGCTGAAGGCTCAGGG + Intergenic
980184674 4:129446537-129446559 CAACTCCAGCCAGGGGCTCAGGG + Intergenic
980489424 4:133505988-133506010 CAACTCCAACCAGAGGCTCAGGG + Intergenic
980744648 4:136999167-136999189 TAGCTCCAGCCAGAGGCTTAGGG - Intergenic
980787397 4:137572771-137572793 CAACTCCAGCCAGAGGGTCAGGG - Intergenic
980864863 4:138542656-138542678 CAACTCTAGCCAGAGGCTCAGGG + Intergenic
981237571 4:142436218-142436240 CAACTCCAGCCAGGTGCTCAGGG + Intronic
982528242 4:156506051-156506073 TAACTCCAGCCAGAGGCTCGGGG + Intergenic
982588342 4:157271702-157271724 TAACTCCACCCACAACCTCCAGG - Intronic
983628470 4:169826508-169826530 TGTCTCCAGGCAGAGCCTCCTGG + Intergenic
983726956 4:170940711-170940733 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
984215771 4:176911111-176911133 TAACTCCAGCCAGAGGTGCAGGG + Intergenic
984335027 4:178379416-178379438 TAACTCCAGCCACAGGCTGAAGG + Intergenic
984626090 4:182009408-182009430 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
984836485 4:184026935-184026957 TACCTCCAGCCAGATGATCAAGG - Intergenic
985936532 5:3101802-3101824 GAGCTCCATCCAGAGGCTCCAGG - Intergenic
986492449 5:8306780-8306802 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
986831422 5:11583292-11583314 TACCTCCATCCAGGTGCTCCAGG - Intronic
987399814 5:17463681-17463703 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
987453885 5:18119663-18119685 TAACTCCAGCTAGAGGTTCAGGG + Intergenic
987773025 5:22330858-22330880 TGAGTCCAGGCATAGGCTCCTGG + Intronic
987834677 5:23146120-23146142 TAACTCTAGCCAGAGGCTCAGGG - Intergenic
987836537 5:23170062-23170084 TAACTGCAGCCCCAAGCTCCTGG + Intergenic
988059525 5:26149017-26149039 TAACTCCAGCCAGAAGCTCAGGG + Intergenic
989092063 5:37743732-37743754 TAACTCCAGCCAGAGGCTCAGGG + Intronic
989348191 5:40453597-40453619 CAATTCCAGCCAGGGGCTCAGGG - Intergenic
990016053 5:51063847-51063869 CAACTCCAGCTAGGGGCTCGGGG + Intergenic
990139065 5:52682367-52682389 TAACTCTAGCCAGAGGCTCAGGG - Intergenic
992729579 5:79648231-79648253 TTACTCCAGCCTCAAGCTCCTGG - Intronic
992737944 5:79742577-79742599 TAACTGCAGCCATTGGCTCCTGG - Intronic
993587309 5:89746900-89746922 CAACACCATCCAGAGGCTCAGGG - Intergenic
993589615 5:89778200-89778222 CAACTCCAGCCAGGGGTTCAGGG + Intergenic
993807933 5:92436266-92436288 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
994344548 5:98669055-98669077 TAACTCCAGCCAGAGGCTCAAGG + Intergenic
994843154 5:104951724-104951746 CAACTCCAGCCAGGGGCTTAGGG - Intergenic
995003028 5:107158201-107158223 TAACTGCAGCCAGAGGTTCAGGG + Intergenic
995080689 5:108047755-108047777 CAACTCCAGCCAGAGGCTCAGGG + Intronic
995594190 5:113730914-113730936 TAGCTCCAGCCAGAGGCTCAAGG - Intergenic
995666206 5:114544971-114544993 CAACTCCAGCCAGAGGCTTATGG + Intergenic
995685337 5:114766281-114766303 TACCTCCAGCCAAAGGCTGAGGG - Intergenic
995853979 5:116574119-116574141 GGACTCCAGCCTGAGGGTCCCGG - Intronic
995960127 5:117829601-117829623 CAACTCCAGCCAGAGGCTTATGG - Intergenic
996675722 5:126172374-126172396 CAACTCCAGCCAGGGGCTCAAGG + Intergenic
997096959 5:130924013-130924035 TAACTCCAACCAGATGCTCAGGG + Intergenic
997331187 5:133063169-133063191 TTACTGCAGCCTCAGGCTCCTGG + Intronic
998461488 5:142313541-142313563 TAAATCCATCCTGTGGCTCCGGG + Exonic
998755597 5:145375656-145375678 TAACTCCAGCTAGAGGCTCAGGG - Intergenic
998788848 5:145744137-145744159 TAACTCCATCCAGAGGCTCAGGG + Intronic
999265370 5:150263901-150263923 AAACAGCAGCCAGAGGCTCCGGG - Intronic
999596921 5:153215011-153215033 CAACTCTAGCCAGAGGCTCAAGG + Intergenic
1001191756 5:169638003-169638025 GAGCTCCAGGCAGAGGCTTCTGG - Intronic
1001355889 5:171022474-171022496 TAACTCCAGCCAGAGGGTCAGGG - Intronic
1001703659 5:173725475-173725497 AGACTCCAGCAAAAGGCTCCTGG + Intergenic
1001788847 5:174437247-174437269 TAATTCCCACCAGAGGCTCAGGG + Intergenic
1001839682 5:174864657-174864679 TAACTCCAGCCAGAAGCACAGGG - Intergenic
1003248772 6:4406090-4406112 CAACTGCAGCCAGAGGCTCAGGG + Intergenic
1003687078 6:8315021-8315043 TAACACCAGCCAGAGGCTCAGGG - Intergenic
1004392889 6:15224053-15224075 TGTCTCCAGGCTGAGGCTCCTGG + Intergenic
1004665806 6:17747663-17747685 TCACTGCAGCCTGAGCCTCCTGG + Intergenic
1004760130 6:18656835-18656857 CAACTCTAGTCAGAGGCTCAGGG + Intergenic
1005087512 6:22022117-22022139 GAGCTCCTGCCAGAGGCTCTGGG + Intergenic
1005121017 6:22389654-22389676 TAACTCCAGCTAGAGGCTCAGGG - Intergenic
1005170637 6:22980760-22980782 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
1005330084 6:24741371-24741393 TAACTGTAGCCTGAAGCTCCTGG - Intergenic
1006599207 6:35214408-35214430 TAGCTCCAGCCATGGGCTCGGGG + Exonic
1007077538 6:39077579-39077601 TCACTTCTGCCAGAGGTTCCTGG + Intronic
1008244225 6:49150651-49150673 CAACTCCAGCCAGGGGCTCAGGG - Intergenic
1008468236 6:51854608-51854630 TAACTCCAGCCAGAGGCTCCGGG - Intronic
1008558907 6:52704250-52704272 TAACTCCACCCAGTTTCTCCAGG - Intergenic
1008773631 6:55009073-55009095 TAACTCCAGCCAGGGGCTCAGGG - Intergenic
1009494628 6:64331835-64331857 TGCCTCAAGCCAGAGGCTACTGG + Intronic
1009916769 6:70005841-70005863 TAACTCCAGCCAGAGGCTCCGGG - Intronic
1010331307 6:74626771-74626793 TAACTCCAGCCTTAGGCTCAGGG + Intergenic
1010483194 6:76379150-76379172 TAATTCCAGCCAGAGGTTCAGGG - Intergenic
1010489038 6:76452480-76452502 CCACTCCAGCCCGCGGCTCCAGG + Intergenic
1010559751 6:77334186-77334208 CAACTCCAACCTGTGGCTCCTGG - Intergenic
1011321116 6:86094716-86094738 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
1011944201 6:92880728-92880750 TAACCCCAGCCAGAGGCTCAGGG + Intergenic
1013461540 6:110379031-110379053 TAATGCCAGCCAGAGGCTTAGGG + Intergenic
1013920448 6:115396581-115396603 TAACTCCAGCCATGGGTTCATGG - Intergenic
1014084789 6:117330284-117330306 TAACTGCAGCCAGAGGCTCAGGG + Intronic
1014224538 6:118832849-118832871 TATCTCCAGCCTGTGGCACCAGG + Intronic
1014389893 6:120848916-120848938 TCACTGCAGCCACTGGCTCCTGG + Intergenic
1014422324 6:121261098-121261120 CAACTCCAGCCAGTGGCTCAGGG + Intronic
1015358216 6:132305328-132305350 TGACTCCAACTAGAGGCTCAGGG + Intronic
1015660153 6:135566256-135566278 CAACTCCAGCCAGGGGCTCAGGG - Intergenic
1015764815 6:136705367-136705389 TCACTACAGCCACAAGCTCCTGG + Intronic
1016814007 6:148287015-148287037 GGACTCCACCCATAGGCTCCTGG - Intronic
1016834565 6:148464483-148464505 TTCCTCCAGCCAGAAGCCCCAGG - Intronic
1017396196 6:154002521-154002543 CGACTCCAGCCCGTGGCTCCTGG + Intergenic
1017501917 6:155033661-155033683 TAACTTCTGCCATTGGCTCCTGG + Intronic
1018812253 6:167306682-167306704 AAACCCCAGGCAGAGCCTCCAGG - Intronic
1019113512 6:169737991-169738013 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1019455170 7:1123126-1123148 CAACGCCAGACAGAGGCACCAGG + Intronic
1020621812 7:10528060-10528082 TAACGACAGCCAGAGGCTCAGGG + Intergenic
1020633771 7:10672081-10672103 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1021462471 7:20904035-20904057 TCACTGCAGCCTGATGCTCCTGG + Intergenic
1021776524 7:24059877-24059899 CAACTCCAGCCAGAGGTTTAGGG + Intergenic
1021813976 7:24429920-24429942 TAACTCCAGGCAGATATTCCTGG + Intergenic
1022434795 7:30372579-30372601 TCACTTCAGCCTGATGCTCCTGG - Intronic
1022634662 7:32120202-32120224 CAACTCCAGCCAGAGGCTCAGGG + Intronic
1023207210 7:37763724-37763746 CAACTCCAACCAGGGGCTCAGGG + Intronic
1024099521 7:46015873-46015895 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
1025174555 7:56791550-56791572 CAACTCCAGCCAGCGGATGCAGG - Intergenic
1025697247 7:63784863-63784885 CAACTCCAGCCAGTGGATGCAGG + Intergenic
1025800199 7:64779886-64779908 TGACTCCAGCCCCTGGCTCCTGG - Intergenic
1026116091 7:67496937-67496959 TAACTGCAGGCCCAGGCTCCTGG - Intergenic
1027944053 7:84723041-84723063 TAACTCCAGCCAGAGGCTCAAGG + Intergenic
1028048933 7:86158592-86158614 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
1028459204 7:91071978-91072000 CAACTCCAGGCAGGGGCTCAGGG + Intronic
1028518008 7:91699021-91699043 GAACTCCAGCCAGGGGCTCAGGG + Intronic
1028644162 7:93076821-93076843 CAACTCCAGCCAGAGGCTCAAGG + Intergenic
1029039512 7:97557985-97558007 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
1030908374 7:115214545-115214567 TTACTCCTTCCAGAGGATCCAGG + Intergenic
1032339492 7:131057858-131057880 TACCTCCAGCCTCAGCCTCCCGG - Intergenic
1032672191 7:134095058-134095080 AAACTCCACCGAAAGGCTCCTGG + Intergenic
1032776827 7:135122349-135122371 TAACTCCAGCCAGAGGCTCAGGG + Intronic
1032918140 7:136514324-136514346 TTACTACAGCCTCAGGCTCCTGG - Intergenic
1033493086 7:141863540-141863562 TTCCTCCAGCCAGAGGCTAACGG - Intergenic
1033495286 7:141887832-141887854 TTCCTCCAGCCAGAGGCTGACGG - Intergenic
1033879435 7:145862704-145862726 TAATTCCAGCCAGAGGTTCAGGG + Intergenic
1033989426 7:147265470-147265492 CAACTCCAGCCAGGGGCTTAGGG + Intronic
1034462104 7:151203695-151203717 CAACTCCAGCCAGAGGATGGGGG - Intronic
1035406316 7:158600178-158600200 TAACTGCAGCCTCAGACTCCTGG + Intergenic
1035491715 7:159284983-159285005 TAACTCCAACCAGAGGCTCAGGG + Intergenic
1035599536 8:889474-889496 TAACTCCAGCCAGAAGCTCAGGG - Intergenic
1036515620 8:9440703-9440725 TCACTCCAGCCTCAGCCTCCTGG - Intergenic
1036707959 8:11059340-11059362 AAACGCAAGCCAGAGTCTCCGGG - Intronic
1037312465 8:17571349-17571371 TAGGTCCAGCCAGAAGCTCCCGG + Intergenic
1038022203 8:23560191-23560213 TCACTGCAGCCTGAGCCTCCTGG - Intronic
1038073718 8:24046530-24046552 TAATTCCAGCCAGGGGCTCAGGG + Intergenic
1038243314 8:25830833-25830855 TAACTCCAGCCAGAGGATCAGGG - Intergenic
1039265178 8:35816155-35816177 CAACTCCAGCCAAGGGCTCGGGG + Intergenic
1039293832 8:36127632-36127654 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1039402255 8:37279691-37279713 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
1039582508 8:38678347-38678369 TAACTCCAGCCTCAACCTCCTGG - Intergenic
1039685908 8:39801698-39801720 TAACTCCAGCCAGAGGCTCAGGG - Intronic
1040614166 8:49018231-49018253 GAACTCCAGCCAGGGGCTCAGGG - Intergenic
1040762974 8:50873758-50873780 CAACTTCAGCCAGAGGCTCAGGG - Intergenic
1040763118 8:50874470-50874492 CAACTTCAGCCAGAGGCTCAGGG + Intergenic
1040959792 8:53019375-53019397 CAACTCCAGCCAGAAGCTCAGGG + Intergenic
1041021370 8:53642393-53642415 CAACTCCAGCCAGGGACTCAGGG - Intergenic
1041743104 8:61177294-61177316 CAACTGCAGCCAGGGGCTCAGGG + Intronic
1042264218 8:66892092-66892114 TCACTCCAGCCTGTGGCTCCTGG + Intronic
1042629976 8:70805715-70805737 TAACTCCAGCCAGAGGCTCCCGG + Intergenic
1042759691 8:72257290-72257312 CAACTCCAGCCAGGGGCTTAGGG + Intergenic
1042787261 8:72562294-72562316 TAATTACAGCTTGAGGCTCCAGG - Intronic
1043233349 8:77830379-77830401 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
1043359664 8:79457825-79457847 TCACTGCAGCCTCAGGCTCCTGG + Intergenic
1044038622 8:87337384-87337406 CAACTCCAGCTAGAAGCTCAGGG - Intronic
1044099977 8:88123013-88123035 TAACTCTAGCCAGAACCACCTGG + Intronic
1044356127 8:91224867-91224889 TAACTCCAGCCAGAGGCTCAGGG - Intronic
1046338871 8:112826018-112826040 GAACTCCAGCCAGGGGCTCAGGG - Intronic
1047176994 8:122551215-122551237 TAGCTCCAGCCCCAGGATCCAGG + Intergenic
1047543847 8:125796920-125796942 TCACTCCAGCCTGCGGCTCTTGG + Intergenic
1050482097 9:6097766-6097788 CATCACCAGCCAGAGGTTCCTGG + Intergenic
1050563274 9:6856645-6856667 TAACTGCAGCCACAACCTCCTGG + Intronic
1050630122 9:7549700-7549722 CAACTTCAGCCAGAGACTCAGGG + Intergenic
1051003612 9:12315217-12315239 TAACTCCAGCCAAAGGCTCAGGG - Intergenic
1052026587 9:23580129-23580151 CAACTCCAGACACAAGCTCCAGG - Intergenic
1052199762 9:25764018-25764040 TAACTCCAGCCAAGGGCTCAGGG + Intergenic
1052225265 9:26077824-26077846 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1052369260 9:27645628-27645650 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
1052546668 9:29889058-29889080 TAACTCCATTTAGAGGCTCAGGG + Intergenic
1053017132 9:34668299-34668321 GAAGAGCAGCCAGAGGCTCCAGG + Intergenic
1053281862 9:36825728-36825750 CACCTCCAGGCAGAGTCTCCAGG - Intergenic
1053458606 9:38251066-38251088 TAACCCAATCCAGAGGCTACAGG - Intergenic
1053678733 9:40464931-40464953 CAACTCCAGCCAGAGGTTTATGG + Intergenic
1053928718 9:43093284-43093306 CAACTCCAGCCAGAGGTTTATGG + Intergenic
1054284990 9:63160011-63160033 CAACTCCAGCCAGAGGTTTATGG - Intergenic
1054291811 9:63300469-63300491 CAACTCCAGCCAGAGGTTTATGG + Intergenic
1054389829 9:64605012-64605034 CAACTCCAGCCAGAGGTTTATGG + Intergenic
1054505885 9:65911364-65911386 CAACTCCAGCCAGAGGTTTATGG - Intergenic
1056306700 9:85297932-85297954 GCACTCCCTCCAGAGGCTCCAGG + Intergenic
1057264323 9:93603968-93603990 TGACTCCAGCAATAGGCTGCTGG - Intronic
1057454980 9:95199682-95199704 AAACTACCACCAGAGGCTCCTGG + Intronic
1058591046 9:106565590-106565612 CAACTCCAGCCAGAGGCTCAGGG + Intergenic
1058729488 9:107836236-107836258 CAACTCCAGCCACACTCTCCTGG + Intergenic
1058986236 9:110210678-110210700 TAACTTAGACCAGAGGCTCCAGG + Intergenic
1059158698 9:112013265-112013287 TCACTCCAGCCTGCAGCTCCTGG + Intergenic
1059596317 9:115724294-115724316 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
1059746187 9:117204037-117204059 TAACTCCAGCCAGAGGCTCTGGG - Intronic
1059895163 9:118856050-118856072 CAACTCCAGCCAGGGGCTCTGGG + Intergenic
1060321093 9:122562020-122562042 CAACTCCCGCCAGGGGCTCAAGG - Intergenic
1060412323 9:123408038-123408060 GAACTCCAGCCACAGGTGCCAGG + Intronic
1061237725 9:129352177-129352199 CAGCTCCCGCCAGAGGGTCCGGG + Intergenic
1203691478 Un_GL000214v1:47015-47037 CACCACCAGCCAGAGGCTTCAGG - Intergenic
1203746984 Un_GL000218v1:45314-45336 TCACTCCAGCCACAGGAGCCGGG + Intergenic
1203563123 Un_KI270744v1:74166-74188 TCACTCCAGCCACAGGAGCCAGG - Intergenic
1203644817 Un_KI270751v1:57176-57198 CACCACCAGCCAGAGGCTTCAGG + Intergenic
1185846258 X:3440900-3440922 TAACTCCATCCAGAGGCTCAGGG - Intergenic
1186274342 X:7923413-7923435 TCACTCTCTCCAGAGGCTCCAGG - Intronic
1186405907 X:9302522-9302544 CAACTCCAGTCAGAGACTACGGG + Intergenic
1186430958 X:9503753-9503775 TAACTCCAGCCAGAGGCTAAGGG + Intronic
1188092183 X:25977219-25977241 TAACTTCAGCCAGAGGCTCAGGG + Intergenic
1188669791 X:32868713-32868735 TAACTCCAGCCAGGGGTTTAGGG + Intronic
1188884360 X:35531516-35531538 CAACTCCAGTCAGAGGCTCAGGG + Intergenic
1189571899 X:42306927-42306949 TAACTCTAGCCAGAGGCTCAAGG + Intergenic
1189757657 X:44286949-44286971 TCACTGCAGCCTGAGACTCCTGG - Intronic
1189995172 X:46631051-46631073 TGATTCCAGCCCCAGGCTCCTGG + Intronic
1190529628 X:51361743-51361765 TAACTCTAGTCAGAGGCTCAGGG + Intergenic
1191775361 X:64807832-64807854 CAACTCCAGCCAGGGGCTCAGGG + Intergenic
1192026367 X:67456898-67456920 CAACTCCATCCAGAGGCTCAGGG + Intergenic
1192726935 X:73763686-73763708 CAACTCCAGCCAGGGGCTCAGGG - Intergenic
1192801204 X:74466163-74466185 TAACACCAGCCACAAGCACCAGG - Intronic
1192930231 X:75799167-75799189 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1192951953 X:76026574-76026596 TAACTCCAGCCAGAGGCTAAGGG + Intergenic
1193039322 X:76987800-76987822 TAACTCCAGCCAGAGGCTCAGGG + Intergenic
1193048346 X:77076822-77076844 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1193062393 X:77220386-77220408 TAACTCCAGTCAGAGGCTCAGGG + Intergenic
1193091119 X:77494619-77494641 CAACTCCAGCCAGAGGCTCAAGG + Intergenic
1193227244 X:78998455-78998477 TAACTGCAGCCAGTAGCTCAGGG + Intergenic
1193719493 X:84971347-84971369 TAACTCTAGCCAGAGGCTCAGGG - Intergenic
1194523158 X:94943046-94943068 CAACTCCAGCCAGGGTCTCAGGG + Intergenic
1194851987 X:98881266-98881288 CAACTTCAGCCAGGGGCTCAGGG + Intergenic
1195147195 X:102029483-102029505 CAAAGCCAGCCAGAGGCTCAGGG + Intergenic
1195153437 X:102097524-102097546 CAACTCCAGCCAGGGGCTTTGGG + Intergenic
1195983141 X:110601214-110601236 TAACTCCAGCCAGATGCTCAGGG + Intergenic
1196054497 X:111340336-111340358 TAACTCTAGTCAGAGGCTCAGGG + Intronic
1196517255 X:116628456-116628478 TAACTCTGGCAAGAGGCTCAGGG - Intergenic
1196607336 X:117671677-117671699 TAACTCCAGCCAAAGGCTCAGGG - Intergenic
1196995128 X:121373846-121373868 TTACCACAGCCACAGGCTCCGGG - Intergenic
1197046458 X:122004023-122004045 TAACTCCAGCCAGAGGCTCAGGG - Intergenic
1197049533 X:122042369-122042391 CAACTCCAGACAGGGGCTCAGGG - Intergenic
1197403908 X:126027411-126027433 TAACTCCAGCCAGAGTCTCAGGG - Intergenic
1197602125 X:128543311-128543333 TAACTCTAGCCAGAGGCTCAGGG - Intergenic
1197607079 X:128597345-128597367 CAACTCCAGACAGGGGCTCAGGG - Intergenic
1198154500 X:133945532-133945554 TAACTCCAACCAGAGGGTAGAGG - Intronic
1199567394 X:149230107-149230129 CAACTCCAGCCAGGGGCTCAGGG - Intergenic
1200256138 X:154584446-154584468 TCCCACCAGCCAGGGGCTCCCGG - Intergenic
1200261631 X:154619957-154619979 TCCCACCAGCCAGGGGCTCCCGG + Intergenic
1200267613 X:154654254-154654276 TCCCACCAGCCAGGGGCTCCCGG + Intergenic
1200818250 Y:7555504-7555526 TAACTCCATCCAGAGGCTCAGGG + Intergenic
1201896708 Y:18999622-18999644 TGCCTCAAGCCAGAGGCTACCGG + Intergenic