ID: 1042643134

View in Genome Browser
Species Human (GRCh38)
Location 8:70956668-70956690
Sequence GCCTGTTGGTACCCCAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042643123_1042643134 -5 Left 1042643123 8:70956650-70956672 CCCCAGCCCCCCTCCCGTGCCTG No data
Right 1042643134 8:70956668-70956690 GCCTGTTGGTACCCCAAGTCTGG No data
1042643121_1042643134 3 Left 1042643121 8:70956642-70956664 CCCTCAGACCCCAGCCCCCCTCC No data
Right 1042643134 8:70956668-70956690 GCCTGTTGGTACCCCAAGTCTGG No data
1042643122_1042643134 2 Left 1042643122 8:70956643-70956665 CCTCAGACCCCAGCCCCCCTCCC No data
Right 1042643134 8:70956668-70956690 GCCTGTTGGTACCCCAAGTCTGG No data
1042643125_1042643134 -7 Left 1042643125 8:70956652-70956674 CCAGCCCCCCTCCCGTGCCTGTT No data
Right 1042643134 8:70956668-70956690 GCCTGTTGGTACCCCAAGTCTGG No data
1042643118_1042643134 17 Left 1042643118 8:70956628-70956650 CCCATGCTGAGCCACCCTCAGAC No data
Right 1042643134 8:70956668-70956690 GCCTGTTGGTACCCCAAGTCTGG No data
1042643119_1042643134 16 Left 1042643119 8:70956629-70956651 CCATGCTGAGCCACCCTCAGACC No data
Right 1042643134 8:70956668-70956690 GCCTGTTGGTACCCCAAGTCTGG No data
1042643117_1042643134 25 Left 1042643117 8:70956620-70956642 CCTGCAGGCCCATGCTGAGCCAC No data
Right 1042643134 8:70956668-70956690 GCCTGTTGGTACCCCAAGTCTGG No data
1042643124_1042643134 -6 Left 1042643124 8:70956651-70956673 CCCAGCCCCCCTCCCGTGCCTGT No data
Right 1042643134 8:70956668-70956690 GCCTGTTGGTACCCCAAGTCTGG No data
1042643120_1042643134 6 Left 1042643120 8:70956639-70956661 CCACCCTCAGACCCCAGCCCCCC No data
Right 1042643134 8:70956668-70956690 GCCTGTTGGTACCCCAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042643134 Original CRISPR GCCTGTTGGTACCCCAAGTC TGG Intergenic
No off target data available for this crispr