ID: 1042644289

View in Genome Browser
Species Human (GRCh38)
Location 8:70968888-70968910
Sequence TGTGTAAGACCTCCCAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042644289_1042644296 -3 Left 1042644289 8:70968888-70968910 CCCCTTTTGGGAGGTCTTACACA No data
Right 1042644296 8:70968908-70968930 ACAGTCAGGAGGAATGGGATCGG 0: 2
1: 3
2: 33
3: 89
4: 443
1042644289_1042644297 -2 Left 1042644289 8:70968888-70968910 CCCCTTTTGGGAGGTCTTACACA No data
Right 1042644297 8:70968909-70968931 CAGTCAGGAGGAATGGGATCGGG 0: 25
1: 84
2: 212
3: 277
4: 626
1042644289_1042644298 -1 Left 1042644289 8:70968888-70968910 CCCCTTTTGGGAGGTCTTACACA No data
Right 1042644298 8:70968910-70968932 AGTCAGGAGGAATGGGATCGGGG No data
1042644289_1042644295 -8 Left 1042644289 8:70968888-70968910 CCCCTTTTGGGAGGTCTTACACA No data
Right 1042644295 8:70968903-70968925 CTTACACAGTCAGGAGGAATGGG No data
1042644289_1042644294 -9 Left 1042644289 8:70968888-70968910 CCCCTTTTGGGAGGTCTTACACA No data
Right 1042644294 8:70968902-70968924 TCTTACACAGTCAGGAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042644289 Original CRISPR TGTGTAAGACCTCCCAAAAG GGG (reversed) Intergenic
No off target data available for this crispr