ID: 1042657922

View in Genome Browser
Species Human (GRCh38)
Location 8:71120678-71120700
Sequence AATCCCAGCAAGTTATTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1101
Summary {0: 51, 1: 140, 2: 232, 3: 229, 4: 449}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042657922_1042657925 12 Left 1042657922 8:71120678-71120700 CCACAAAATAACTTGCTGGGATT 0: 51
1: 140
2: 232
3: 229
4: 449
Right 1042657925 8:71120713-71120735 GCATTTAAACATATAGATCAAGG No data
1042657922_1042657927 16 Left 1042657922 8:71120678-71120700 CCACAAAATAACTTGCTGGGATT 0: 51
1: 140
2: 232
3: 229
4: 449
Right 1042657927 8:71120717-71120739 TTAAACATATAGATCAAGGTGGG No data
1042657922_1042657926 15 Left 1042657922 8:71120678-71120700 CCACAAAATAACTTGCTGGGATT 0: 51
1: 140
2: 232
3: 229
4: 449
Right 1042657926 8:71120716-71120738 TTTAAACATATAGATCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042657922 Original CRISPR AATCCCAGCAAGTTATTTTG TGG (reversed) Intergenic
900722992 1:4190702-4190724 AATGCCAGCAAGTTATTTTGTGG - Intergenic
900811910 1:4809856-4809878 AATTCCAGGAAGTTATTTTGAGG + Intergenic
901328677 1:8386958-8386980 AATCCCAGCTGGTTAGTTTGTGG + Intronic
901608575 1:10478513-10478535 AATTCCAGCAAGTCGTCTTGAGG - Intronic
902903926 1:19540315-19540337 AATTCCAGCAAGTTATTTTGTGG - Intergenic
902905047 1:19550290-19550312 AAAACCAGCAAGTTTTTATGAGG + Intergenic
903100092 1:21022320-21022342 AAACCCCACAAGTTATTTTTAGG + Intronic
903644164 1:24882312-24882334 AATCCCAGCATGTTATTTTGTGG - Intergenic
904854156 1:33483737-33483759 AATCACAGAAATTTATCTTGTGG - Intronic
904894960 1:33810120-33810142 GATTCCAACAGGTTATTTTGTGG + Intronic
905054517 1:35081455-35081477 AATCCCAGCAGGGGTTTTTGTGG - Intronic
905288314 1:36902193-36902215 AATCTCAGCAAGTTATTTTGTGG + Intronic
905487748 1:38316322-38316344 GATCCCAGAAAGGTATTTTGTGG - Intergenic
907170021 1:52454187-52454209 AATTCTAGCAAGTCATTTTGTGG + Intronic
907757827 1:57327972-57327994 AACCCCAGAAAGTCATTTTCTGG + Intronic
907817181 1:57930408-57930430 AATCCCAGCAAGTTATTTTGTGG - Intronic
907881991 1:58558727-58558749 ACTCTCATCGAGTTATTTTGTGG + Intergenic
908047879 1:60191404-60191426 AATTCCAGCAAGTCACTTTGTGG + Intergenic
908793615 1:67808904-67808926 AATCTCAGAAAATTATTTTATGG + Intronic
908945398 1:69490097-69490119 AATCTGAGCAAATTATTTTGAGG + Intergenic
908975931 1:69898410-69898432 AATCACAGTTAGTTATTGTGTGG - Intronic
908984860 1:70005728-70005750 AATCCTTGCAACTTATTGTGTGG + Intronic
909117526 1:71557221-71557243 AATCCCCTTCAGTTATTTTGTGG - Intronic
909645519 1:77912410-77912432 AATCCCAGCATATTATTTTGTGG + Intronic
909908344 1:81227220-81227242 AATTCCAGGAAGCTATTTTCAGG - Intergenic
909912897 1:81282235-81282257 AATCCCAGAAAGATCTTTGGAGG - Intergenic
909944107 1:81643868-81643890 AATTCTGGCAAATTATTTTGTGG + Intronic
910084741 1:83386442-83386464 AATCCTAGCAAGTTATGTTGGGG + Intergenic
910097151 1:83536673-83536695 AGTCTCAGCAAGTTTTTTGGGGG + Intergenic
910136236 1:83973598-83973620 AATTTCAGCAATTTGTTTTGTGG - Intronic
910161181 1:84274451-84274473 AATCCCAGCGAGCCATTTTGTGG - Intergenic
910372663 1:86533614-86533636 AATCCAAGCAAGTTAGTCTGTGG - Intergenic
910412324 1:86959905-86959927 AATCGCAGCAGGTTATTTTGTGG + Intronic
910494515 1:87811547-87811569 AATCCAAGCAAGTTATACTTGGG - Intergenic
910562292 1:88603615-88603637 ATTCTCAGCAAGTTATTTGGGGG + Intergenic
910677923 1:89833560-89833582 AATCCCAGCACTCTCTTTTGTGG + Intronic
911201086 1:95044206-95044228 AATCCCAGCAAGAGATAATGTGG - Intronic
911286504 1:96000503-96000525 AATAACAGCAAGTTATTTTGTGG + Intergenic
911403184 1:97402151-97402173 AATCCCCGCAAGTTGTGTTGTGG - Intronic
911631865 1:100192543-100192565 AAATCCATCAAGTGATTTTGGGG + Exonic
911806620 1:102217655-102217677 AATCCCAGCAAGTTATTTTGTGG + Intergenic
911868298 1:103056639-103056661 AATCCCAGCAGGTTACTCTGAGG - Intronic
911868688 1:103063177-103063199 TTTCCCAGCATGTTATTTTGTGG + Intronic
911934750 1:103955063-103955085 AATCCCAGCAAGTTATTTACTGG - Intergenic
911936917 1:103988334-103988356 AATACCATCAAGTTATTTTGTGG + Intergenic
912083331 1:105967107-105967129 AATACCAGCAAGTTATTTTGTGG - Intergenic
912149156 1:106835527-106835549 ATTCACAGAAAGTTATTTTGTGG + Intergenic
912563445 1:110566691-110566713 AATCCCAGCTTGCCATTTTGGGG + Intergenic
912660802 1:111528541-111528563 AATTCCACCAAGTTATTTTGTGG - Intronic
912854820 1:113158135-113158157 AATACCAGCAAGTTATTTTGTGG - Intergenic
913028130 1:114867282-114867304 AATCTCAGCAAGTTATATTGTGG - Intronic
913235122 1:116774268-116774290 AATCCCTGCGAACTATTTTGTGG + Intergenic
913577324 1:120189741-120189763 AATCCCAGCAAATTATTTTGTGG + Intergenic
914559237 1:148801168-148801190 AATCCCAGCAAATTATTTTGTGG + Intergenic
914613596 1:149329055-149329077 AATCCCAGCAAATTATTTTGTGG - Intergenic
915257456 1:154645389-154645411 AATCTCAACAAGTTATTTTGTGG - Intergenic
915877934 1:159632186-159632208 AATCCAAACAGTTTATTTTGTGG - Intergenic
916240944 1:162638911-162638933 AATTCTAGCAAGTTGTTTTGTGG + Intronic
916333745 1:163646619-163646641 AATCCCAGAAAGTTATTTTGTGG - Intergenic
916602838 1:166310387-166310409 AATCTCAGCAAGTTATTTTGTGG - Intergenic
916775632 1:167960871-167960893 AATCTCAGCAAATTATTTTGTGG - Intronic
917157127 1:172015296-172015318 AATCCCAGTCAGTTATTTTGTGG - Intronic
917763032 1:178184841-178184863 ATTTCCAGCAAGTTGTTTTGTGG - Intronic
917896600 1:179495224-179495246 AATCTCAGCAAGGTTTCTTGAGG - Intronic
918665654 1:187147220-187147242 AATACCAGCAAGTTAAGTTGTGG - Intergenic
919272569 1:195368378-195368400 AATTCCACTAAGTTATTTTGTGG + Intergenic
919406072 1:197185933-197185955 AATCCCAGAAAGTCATTTTGTGG + Intronic
919440185 1:197624036-197624058 AATCCCAGCAAGTTTTCTTGTGG + Intronic
919809231 1:201398733-201398755 AATCTCAGCATGGCATTTTGGGG - Intronic
921587823 1:216968749-216968771 AATTTCAGCAAGTTAGTCTGTGG - Intronic
921620281 1:217318372-217318394 AATTCTAGCAAGTTATTTTGTGG + Intergenic
921872898 1:220160321-220160343 AATCCCAGCAAGTGGTAGTGAGG - Intronic
922521998 1:226261732-226261754 AATCCCAGCGAGTTGTTTTATGG + Intronic
922704661 1:227783194-227783216 AATCCCTGCAAGTTATTTTGTGG + Intergenic
922893576 1:229081645-229081667 AATTACAGAAAGTTATTTTGTGG - Intergenic
923023075 1:230180642-230180664 AATCCCAGCAAGTTGTTTTGTGG - Intronic
923059844 1:230461376-230461398 AATCTCAGCAATTTAGTTGGTGG + Intergenic
923398642 1:233592602-233592624 ATCCCCAGCAAGTTATTTTCTGG - Intergenic
923708873 1:236369229-236369251 AGTCCCAGCAAGTTACTTTGTGG - Intronic
923832751 1:237576225-237576247 AATCCCAACAAGTGTTTTTATGG + Intronic
923847797 1:237756256-237756278 AATCCCAACCATTTATGTTGAGG - Intronic
923981691 1:239331376-239331398 CATCCCAGCAAGTTATCTTGTGG + Intergenic
924214264 1:241804269-241804291 AACCCCAGAAAATTACTTTGGGG + Intergenic
924306749 1:242697613-242697635 AATACCAGCCAGTAATCTTGTGG - Intergenic
1062778106 10:172707-172729 AATCCCAGCAAGTTATTTCATGG + Intronic
1062962520 10:1583695-1583717 AATCTGAGCAAGTGATGTTGTGG + Intronic
1063082145 10:2777826-2777848 AATAAGAGCAAGATATTTTGTGG + Intergenic
1063224158 10:3999107-3999129 AATCCAAGCAAGTTGTTTTGTGG - Intergenic
1063304243 10:4882096-4882118 ATTACCAGTAAGTTATTTTTGGG - Intergenic
1063855369 10:10245436-10245458 AATCTCTACAAGTTATTTTGTGG + Intergenic
1063912188 10:10841821-10841843 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1063976480 10:11421610-11421632 AATCCCAGCAAGTGATTTTGTGG + Intergenic
1064015269 10:11766678-11766700 AATCCCAGCAAGTTACTGTGTGG - Intergenic
1064039522 10:11947627-11947649 ATGCCCAGCTAATTATTTTGGGG - Intronic
1064184456 10:13149013-13149035 AATCTCAGCAAGTTATTTTGTGG + Intergenic
1064700733 10:18017913-18017935 AGTCCCAGCAAGTTATTTAATGG - Intronic
1064779147 10:18814124-18814146 AACCCCAGAAAGTTATTTTTCGG - Intergenic
1064790028 10:18947569-18947591 AATCCCATCAAGTCGTTTTGTGG - Intergenic
1064838108 10:19557801-19557823 AGTCCTAGCAAGTTATTTTGAGG - Intronic
1065270129 10:24021558-24021580 AATCCCTGCAAATTATTTTGTGG + Intronic
1065469123 10:26058733-26058755 AATCCAAACAAATTATTTTGTGG - Intronic
1065521029 10:26572836-26572858 AATCTCAACAATTTATCTTGTGG - Intergenic
1065677405 10:28192734-28192756 AATCCCAGCAGATTATTTTGTGG + Intronic
1065941695 10:30570346-30570368 AACCTCAGCAAATTATATTGTGG - Intergenic
1066041717 10:31554735-31554757 AATCCCAGCAGGTTACAGTGTGG - Intergenic
1066138551 10:32477865-32477887 AATCCCAGCAAGGTATTTTTTGG - Intronic
1066519653 10:36201771-36201793 AATCCAAGCAAGTTATCTTGTGG - Intergenic
1067016978 10:42764742-42764764 AATTCTAGCAGGTTATTTTGTGG + Intergenic
1067347761 10:45449551-45449573 AATCTCAGCAAGTTATGTTGTGG + Intergenic
1067480184 10:46590004-46590026 AATTCTAGCACTTTATTTTGTGG - Intronic
1067614554 10:47751795-47751817 AATTCTAGCACTTTATTTTGTGG + Intergenic
1067857881 10:49812604-49812626 AATCTCAGCAAATTATTTCATGG - Intergenic
1068049029 10:51925559-51925581 AATCCCAGCAAGTTAGGCTCTGG + Intronic
1068154209 10:53175633-53175655 AATCCTAGAAAGTTATTTTGTGG + Intergenic
1068494450 10:57768731-57768753 AATCACAGCAAGATGCTTTGTGG + Intergenic
1069022889 10:63508509-63508531 AATCCCACTAAGTTACTTTGTGG - Intergenic
1069155428 10:65023847-65023869 AATTCCAGCAAGCTTTTTTGTGG - Intergenic
1069288826 10:66750742-66750764 AATCCTAGCAAGTTATTTTGTGG - Intronic
1069586741 10:69610609-69610631 AATCCCAGCAAGTTGTTTTGTGG + Intergenic
1069647587 10:70014541-70014563 AATCCCAGCAAGTTATTTTGTGG + Intergenic
1069848206 10:71387656-71387678 AATGACAGCAAGTTCTTTTGTGG + Intergenic
1070688374 10:78506886-78506908 AATACCACCAGGTTATTTCGGGG - Intergenic
1071006276 10:80887694-80887716 AATCTCAACAAGCTATTTTTTGG + Intergenic
1071081020 10:81811310-81811332 AATCCCAACAAGTTATTTTGTGG + Intergenic
1071236299 10:83653771-83653793 AATCCCATCAAGCTATTTTGTGG - Intergenic
1071318991 10:84433241-84433263 AATTTCAGCAAGTTATTTTGAGG - Intronic
1071350403 10:84734992-84735014 AATATCCGCAAATTATTTTGTGG - Intergenic
1071629960 10:87211768-87211790 AATTCTAGCACTTTATTTTGTGG + Intergenic
1071704707 10:87985016-87985038 AATCTCAGCAAGTTAATTTGTGG + Intergenic
1072323287 10:94271896-94271918 AAACCCAGCAAGTTTTATTAAGG + Intronic
1072509573 10:96106165-96106187 AAGCCCAGCAAGCTATTTTGTGG - Intergenic
1073334423 10:102695160-102695182 AATCACAGCAAGTTACTTTGGGG - Intronic
1073728446 10:106263168-106263190 AGTCTCAGCAAGTTATTTTGTGG + Intergenic
1073782322 10:106851730-106851752 AAATGTAGCAAGTTATTTTGTGG - Intronic
1074177527 10:111024564-111024586 AATCCCAGAAAGTTGTTTTGTGG + Intergenic
1074244444 10:111674782-111674804 AATCCCAGCAAGTTATTTTGCGG + Intergenic
1074481992 10:113832131-113832153 ACTCCCAGCAAGTTATTTTGAGG + Intergenic
1074918038 10:117977567-117977589 AATCCCAGCAAGTTATTTTGTGG + Intergenic
1075267581 10:121016498-121016520 AATTGCAGCTAGTTATTTTGTGG + Intergenic
1075293978 10:121256588-121256610 AATCCCAGCAAGTATTTTTGTGG + Intergenic
1075345255 10:121677265-121677287 AATAGCAGCAATTTTTTTTGAGG - Intergenic
1075501212 10:122976385-122976407 AACCCCAGCAAGCTGTTTTGTGG + Intronic
1075564100 10:123491278-123491300 AACCGCAGCCAGTTGTTTTGTGG + Intergenic
1075760610 10:124853008-124853030 AATCTCAGCAAGATTATTTGGGG - Intergenic
1075820037 10:125299842-125299864 AATCCCAGCCAGTTATTTTGTGG + Intergenic
1076021002 10:127073266-127073288 AATCCCAGCAAGTTTTTTTGTGG + Intronic
1076123739 10:127957729-127957751 ATCTCCACCAAGTTATTTTGTGG - Intronic
1076499037 10:130921335-130921357 AACACCAGCAAGTTACTGTGTGG - Intergenic
1076622107 10:131796790-131796812 AACTCCAGCAAGTTATTTTGTGG - Intergenic
1076635268 10:131877889-131877911 AATCCCAGTGAGTTATTTCATGG + Intergenic
1078050251 11:7959443-7959465 GATCCCAGCAAATAACTTTGTGG - Exonic
1078058363 11:8026787-8026809 AATTCCAGCAGGTTTTTTGGGGG - Intronic
1078173188 11:8945895-8945917 TATCCCAGAAAGTTATTTTGTGG - Intergenic
1078294023 11:10047234-10047256 AATCCCAGCAAGTTATTTTATGG + Intronic
1078497668 11:11835926-11835948 AATTCTGGCAAGTTATTTTGAGG + Intergenic
1078503859 11:11913998-11914020 AAGTCCAGCAAGATTTTTTGAGG + Intronic
1078558463 11:12350569-12350591 AACCCCAGGAAGTAATTTTAAGG + Intronic
1078571978 11:12466916-12466938 AATCACAGAAAGCTATTTTGTGG - Intronic
1078805589 11:14697609-14697631 AATTCCATTAAGTTTTTTTGTGG - Intronic
1078960195 11:16257171-16257193 AATTGCAGCAAATTGTTTTGAGG + Intronic
1078989023 11:16626572-16626594 AATCCCAGCAGGCTTTTTTGAGG - Intronic
1079684690 11:23343741-23343763 AATTCCAGCAAGCTATTTTGTGG + Intergenic
1080166952 11:29249645-29249667 TATTTCAGCAAGTTATCTTGTGG + Intergenic
1080305908 11:30835649-30835671 TAACTCAGCAAGTTATTTTGTGG + Intronic
1080373477 11:31679810-31679832 AATCCAAGCAAGTTATTTTATGG - Intronic
1080812591 11:35720067-35720089 AATCCTAGCAAGTTATTTTGTGG - Intronic
1080890866 11:36408153-36408175 AATCCCAGCCAGCTATTTTTGGG + Intronic
1081097587 11:38958023-38958045 AATACAAGCAAGATATTTTGTGG + Intergenic
1081349404 11:42030887-42030909 AAGCTCAGCAAGTTATTTTGTGG + Intergenic
1081555193 11:44153047-44153069 AATCTCAGCAAGTTATTTTGTGG - Intronic
1082065616 11:47897498-47897520 AATAAAAGCAAGATATTTTGTGG + Intergenic
1082246747 11:49932256-49932278 AACCCCAGCAAGTTAGGGTGTGG - Intergenic
1082721787 11:56686749-56686771 AGTTACAGCAGGTTATTTTGTGG + Intergenic
1084015490 11:66377749-66377771 AATCCCAGAAAATTATTTTGTGG - Intergenic
1084090445 11:66875988-66876010 AGTCCAAGCCAGTTATTCTGTGG - Intronic
1084366210 11:68701867-68701889 AATTCTGGCAAGTTATTTTGTGG + Intergenic
1085334426 11:75679959-75679981 AATCCCAGGAGGTTATTTTGTGG - Intergenic
1086149994 11:83598576-83598598 TTTCCCAGCAGGTTATTTTGAGG + Intronic
1086543142 11:87936706-87936728 AATCCCACCAAGATTTTTTGTGG - Intergenic
1087242381 11:95793683-95793705 AATCTCAGAAGGTTATTGTGAGG - Intronic
1087493438 11:98858263-98858285 AATCACAGCAAATTATTTTGTGG + Intergenic
1087802662 11:102520415-102520437 AATCCCACCACACTATTTTGAGG - Intergenic
1087999710 11:104862855-104862877 AATTCCAGCAAGTTATTTTGTGG + Intergenic
1088028201 11:105212975-105212997 AATAGCAGCAGATTATTTTGTGG + Intergenic
1088032758 11:105271458-105271480 TATCTCAGGAAGTTGTTTTGTGG - Intergenic
1088390713 11:109311624-109311646 AATTTCAGCAAGATATCTTGGGG - Intergenic
1088445295 11:109920189-109920211 AATCCCAGTAAGTTATTTTGTGG - Intergenic
1088634126 11:111803114-111803136 AATCCCAGCAAGTTATTTTGTGG + Intronic
1088929650 11:114338573-114338595 AATCCTAGTAAGATATTTTGTGG + Intergenic
1089591582 11:119545394-119545416 AATCCAAGTAAGTTATTTTGTGG - Intergenic
1090108720 11:123881299-123881321 AATCTCAGCAAGTTATTTTGTGG + Intergenic
1090219658 11:125008054-125008076 AATCTCAACAAGTTATTTCGTGG - Intronic
1090481812 11:127075636-127075658 GATCTCAGCAAGTTTATTTGGGG + Intergenic
1090544231 11:127745574-127745596 AATCTCAGCAAGTCATTTGGTGG - Intergenic
1090564812 11:127977549-127977571 AATCCCAGAAAGTTATATTGAGG - Intergenic
1090700707 11:129292715-129292737 AATCCCAGTAAGATATTTTTAGG + Intergenic
1091340107 11:134804822-134804844 ATTCTCAGCAAGCTATTTTGTGG - Intergenic
1091892056 12:4065204-4065226 AATCTGAGCAAGCTATTTTGTGG - Intergenic
1091895501 12:4100296-4100318 AATCCCAGCAAGTTATTTTGTGG + Intergenic
1091949126 12:4577657-4577679 AATCCTAGCAAGTTATTTTATGG - Intronic
1092131638 12:6117246-6117268 AATCCCACCAAGGGGTTTTGAGG + Intronic
1092577557 12:9803965-9803987 AATCCCAGCAAGTTATTTCCAGG - Intergenic
1093343207 12:18005471-18005493 TATCCCAGCAAATTATTTTTTGG + Intergenic
1093590081 12:20892323-20892345 CAGCACAGCAAGTTATTTTCAGG + Intronic
1093591792 12:20910481-20910503 AATCTCTATAAGTTATTTTGTGG - Intronic
1093736120 12:22622865-22622887 AATCACCTCAAGTTATGTTGTGG - Intergenic
1093796503 12:23319562-23319584 AATCCCAGCTCATTTTTTTGTGG + Intergenic
1093836725 12:23840444-23840466 AATCCAAGTAAGTTATTTTGTGG + Intronic
1093848295 12:24002611-24002633 AATGCCAGCAGGTTTTTTTTTGG - Intergenic
1093900804 12:24629625-24629647 AATTCCTGCAAATTATTTTGTGG - Intergenic
1094056961 12:26277849-26277871 ATTCCCCCTAAGTTATTTTGTGG + Intronic
1094394151 12:29987092-29987114 AATTCCAGCAAGTTATTTTTTGG - Intergenic
1094432205 12:30381671-30381693 AATCTCAGCAAGTAATTTTGTGG + Intergenic
1094599178 12:31893423-31893445 AATGACAGCCACTTATTTTGAGG + Intergenic
1094789349 12:33893350-33893372 AATCCCAGCAAGTTATTTTGTGG + Intergenic
1095165132 12:38963373-38963395 AATCTAAGAAAGATATTTTGAGG - Intergenic
1095198559 12:39354848-39354870 AATCTCAGAGAGTTATTATGGGG - Intronic
1095501633 12:42846400-42846422 AAGCCCAGCCAGACATTTTGGGG + Intergenic
1095835538 12:46634502-46634524 ACTCCCAGCAAGTTATTTTGTGG - Intergenic
1096564236 12:52463428-52463450 AATCCCAGCAAAGTACTTTGTGG + Intergenic
1096999739 12:55866576-55866598 AATCCCAGAAAGTTGTATTTTGG + Intergenic
1097256244 12:57677123-57677145 AATCCTAGCAAGTTGTTTTGTGG + Intergenic
1097413750 12:59288295-59288317 AATCCAAGAAAGTTGTTTTGTGG - Intergenic
1097455194 12:59791804-59791826 AATCCTAGCCAGTTATTTTGTGG - Intergenic
1097513335 12:60571006-60571028 AATCCCAGGAAGTTATTTTGTGG + Intergenic
1097588088 12:61539461-61539483 AAACCCAGCAAGAGATTTTGAGG + Intergenic
1097708143 12:62889231-62889253 AATTTCAGCACATTATTTTGTGG + Intronic
1097932250 12:65201325-65201347 AATCCCAGCAGATTATTTTCGGG - Intronic
1098000482 12:65936983-65937005 AAGCCCAGTGAGTTATTTGGAGG + Intronic
1098037000 12:66313907-66313929 ATTAATAGCAAGTTATTTTGGGG - Intronic
1098696506 12:73563993-73564015 AATCCCGGGAAGCTATTTTGTGG + Intergenic
1098734730 12:74085231-74085253 AATTCCAGCAAGTTATTTTGTGG - Intergenic
1098776310 12:74623409-74623431 AATTCCAGCAAGTTATTTTGTGG + Intergenic
1098832981 12:75386120-75386142 AATTTCAGCAAGTTAATTTGTGG + Intronic
1099064159 12:77952635-77952657 AAATCCAGGAAGTTATTTTGTGG - Intronic
1099383341 12:81982976-81982998 ATTCCCAGGAAGTTATTTTGTGG + Intergenic
1099561269 12:84176911-84176933 AATCCTAGTAGATTATTTTGGGG + Intergenic
1099563365 12:84207630-84207652 AATCTCAGGAAGCTATTTTGTGG - Intergenic
1099584300 12:84496858-84496880 CATCCAACCACGTTATTTTGTGG - Intergenic
1099629305 12:85120557-85120579 AATTATAGCAAGGTATTTTGTGG - Intronic
1099821136 12:87711828-87711850 AATCCCAGAAAACTATTTTGTGG + Intergenic
1099895178 12:88636202-88636224 AATCTCAGCAAGCTATTTTGTGG - Intergenic
1100059409 12:90554995-90555017 AATTCCAGTAGGTTACTTTGTGG - Intergenic
1100344832 12:93718200-93718222 AATCCCAGCACACTATTTTGTGG - Intronic
1101026578 12:100613282-100613304 AATACCAGTAATTCATTTTGAGG + Intronic
1101142215 12:101808225-101808247 AATTTCAGCAAGTTATTTTGGGG + Intronic
1101649567 12:106663087-106663109 AATCCCAGCAAGTTATTTTCTGG - Intronic
1104130425 12:125888223-125888245 AATCCCAACAAGTTATTTTGTGG - Intergenic
1104238783 12:126966433-126966455 AATCCCAGCAGGCTACTCTGTGG + Intergenic
1104278095 12:127348957-127348979 AATGCCAGCAAGTTATTTTGAGG + Intergenic
1104616602 12:130275531-130275553 AATCCCAGCAAGTTATCTTGTGG - Intergenic
1104711001 12:130986178-130986200 AATCTCATCAAGTTATTTTGTGG - Intronic
1105670204 13:22605185-22605207 AATCTCAGCAAGTGATTTTGTGG + Intergenic
1106150146 13:27092329-27092351 AATCCCAGCAAGTTATTTTGTGG + Intronic
1106556646 13:30814995-30815017 AATTCCAACAAGTTTTTGTGTGG - Intergenic
1106771641 13:32966796-32966818 TATCCCAGCAAGTTATTTTATGG - Intergenic
1107142078 13:37010473-37010495 AACTAAAGCAAGTTATTTTGAGG + Intronic
1107160424 13:37219613-37219635 AATCTCAGCAAGTTATTTTGTGG - Intergenic
1107257301 13:38443468-38443490 AATCCTAGCAACTTATTTTGTGG - Intergenic
1107266091 13:38556589-38556611 AACTCCAGCAAGTTATTTTGTGG - Intergenic
1107663809 13:42668233-42668255 AAACCCAGCAAGTTAGTTTGTGG + Intergenic
1108137153 13:47377733-47377755 AATTTCAGCAAGCTATTTTGGGG - Intergenic
1108368117 13:49738382-49738404 AATTCAACCAAGATATTTTGTGG - Intronic
1108392750 13:49963641-49963663 AATCCAGTCAAGTTACTTTGTGG + Intergenic
1108819535 13:54330844-54330866 AGTCTCAGAAAGTTATTTGGTGG + Intergenic
1108998178 13:56762284-56762306 AAATCTAGCAAGTTATTTTGTGG + Intergenic
1109239679 13:59870503-59870525 AGTTCCAGCAAGTTATTTTATGG - Intronic
1109459312 13:62634304-62634326 AATCCTAGCAGGTTATTTTGTGG + Intergenic
1109510059 13:63360024-63360046 AACCCCAGGAAGTTATTTTGTGG + Intergenic
1109596571 13:64563549-64563571 AATCCCAGTGAGTTATTTTGAGG - Intergenic
1109648738 13:65296199-65296221 AATCTCAGAAGATTATTTTGTGG + Intergenic
1109812642 13:67535118-67535140 AATTCTACCAAGATATTTTGTGG + Intergenic
1109901819 13:68782777-68782799 AATCTCATCAAGTTATTTTGTGG - Intergenic
1109980374 13:69898663-69898685 AATGTCAGCAAGTCCTTTTGGGG - Intronic
1110080437 13:71303496-71303518 AATCCCAGCACTTTTTTCTGAGG + Intergenic
1110203075 13:72876462-72876484 AATCCCAACAATCTATTTTGTGG - Intronic
1110346606 13:74455372-74455394 AACCCCAATAAGTTATTTTGTGG + Intergenic
1110753532 13:79144714-79144736 CATCACAGCAAGTTATTTTATGG - Intergenic
1110945479 13:81409834-81409856 AATCCTAGCAAGTTAATTTGTGG - Intergenic
1111263138 13:85770014-85770036 AATCCCAACAAGGTATTTTGTGG - Intergenic
1111273805 13:85921761-85921783 AATCACAGTAAGATATTTTCGGG + Intergenic
1111644007 13:91007128-91007150 AATCTCAGCTATTTAGTTTGAGG + Intergenic
1112069925 13:95838412-95838434 AGGCTTAGCAAGTTATTTTGTGG + Intronic
1112127535 13:96485114-96485136 AATCCCAGCAAGTTATTTTGTGG - Intronic
1112988707 13:105484361-105484383 AATCCCAGCAAGCTACATTGTGG - Intronic
1113017932 13:105849560-105849582 CATCCCAAAAACTTATTTTGAGG - Intergenic
1114230728 14:20779695-20779717 TATCCCAGCACATTATTTTGTGG - Intergenic
1115011273 14:28548320-28548342 AATCCCAAGAAGTCATTTTGTGG - Intergenic
1115011289 14:28548613-28548635 AATCCCAAGAAGTCATTTTGTGG + Intergenic
1115110214 14:29812368-29812390 TATTCAAGCAAGTTATTTTAAGG - Intronic
1115169429 14:30487381-30487403 AATCCCAGCAATTTACGTTGTGG + Intergenic
1115244629 14:31282473-31282495 AATCAAAGCAATTTCTTTTGAGG - Intergenic
1115586671 14:34821084-34821106 AATCCCCGCAAGTTATTTTGTGG - Intronic
1115639880 14:35327868-35327890 AAACTCAGCAAGTTATTTTGTGG + Intergenic
1115817956 14:37183289-37183311 AATCTCAGTAAGTTATTTTGTGG + Intergenic
1115878162 14:37884284-37884306 AATTTCAGCAAATTATTTTGTGG - Intronic
1116400574 14:44501422-44501444 AATCCCAGCAAGCGGTTTTGTGG + Intergenic
1116442586 14:44970068-44970090 ACTCTCAGCAACTTATTTTTTGG - Intronic
1116504172 14:45658060-45658082 AATCTCAGCAAGTTATTTTGAGG - Intergenic
1117259335 14:54014587-54014609 AATCCCAGCAAGTTATTTTCTGG - Intergenic
1118018654 14:61688057-61688079 AACCCCAGCAACTTAGTTTGTGG - Intergenic
1118066325 14:62194970-62194992 AATCCAAGAAAATTATTTTGTGG - Intergenic
1118672985 14:68150342-68150364 AATCCAAACAAGTTACTTTATGG - Intronic
1118840908 14:69510224-69510246 AATCCCAGCATGTTGTTTTGTGG - Intronic
1119277893 14:73376475-73376497 AATCCCGACAAGTTATTTTGTGG + Intronic
1119298708 14:73553351-73553373 AAGCCCAGCTAATTATTTTTTGG - Intronic
1119796309 14:77401038-77401060 AATCCCAGGAAATTATTTTGTGG + Intronic
1119941349 14:78644644-78644666 AATCCCAGCCAGATCTTTCGGGG + Intronic
1120078990 14:80193803-80193825 AATCCCAGCAAGTTATTTTGTGG + Intergenic
1120357849 14:83457134-83457156 GATCCAAGCCAGTTATTTTTAGG - Intergenic
1120455235 14:84721422-84721444 AATAAAAGCAAGATATTTTGTGG + Intergenic
1121094962 14:91211293-91211315 AATCCCAGTAAGTTATTTTGTGG + Intronic
1121430868 14:93887359-93887381 AATCTCAGCAAGTTATTTTCTGG - Intergenic
1121480892 14:94272124-94272146 AATCCCAACAAGTTATTTGGTGG + Intronic
1121500531 14:94432765-94432787 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1122332677 14:100934262-100934284 AACCCCAGGAAGTTATTTTGTGG - Intergenic
1122360449 14:101157796-101157818 AATCCTAGCAAGTTATTTTGTGG - Intergenic
1123186558 14:106523271-106523293 AAGCCCAGAAACTTATTTTGTGG - Intergenic
1123737226 15:23197115-23197137 ATTGCCAGCATGTTATTTTTTGG - Intergenic
1123752712 15:23370702-23370724 AGTCACAGTAAGTTATTTTTGGG + Intergenic
1123969842 15:25497258-25497280 AATCTCAGGGAGTTATTTTGTGG + Intergenic
1124122571 15:26902173-26902195 AATTCAAGCACGTTGTTTTGTGG - Intronic
1124318881 15:28696374-28696396 AGTCACAGTAAGTTATTTTTTGG - Intergenic
1124417356 15:29483805-29483827 AATCTCAGCAAGTGATTTTGAGG - Intronic
1124452799 15:29811802-29811824 CAGCCCAGCAAGATGTTTTGTGG - Intronic
1124713743 15:32037455-32037477 AATCCCAGAAGGTTATTTTGTGG - Intronic
1125056859 15:35369834-35369856 AATCCAAGCAAGTTTTTTTGTGG + Intronic
1125126833 15:36233826-36233848 AATCCCAGCAAGGTGCTTTGTGG + Intergenic
1125135648 15:36338188-36338210 AATTGCAGCAAGATATTTCGTGG - Intergenic
1125764608 15:42125717-42125739 AATCCCAGCAAGCTATTTTGTGG - Intergenic
1126016640 15:44358010-44358032 AATCCCAGGAAGTTATTTTGTGG + Intronic
1126611741 15:50536908-50536930 AATCCCAGCAACTTATTTTGTGG + Intronic
1126830326 15:52596282-52596304 AATCTCAGCAGGCTATTTTGTGG + Intronic
1127175225 15:56347193-56347215 AATCCCAGCAAGTTGTTTTGTGG + Intronic
1127345483 15:58093421-58093443 AATCCCAGTAAGTATTTTTGTGG + Intronic
1130009988 15:80143927-80143949 AATCCTAGCATGTTATTTTGTGG + Intergenic
1130164985 15:81446164-81446186 AATCCCAGAAAGTTATTGTGTGG + Intergenic
1130582315 15:85149139-85149161 AATCCCAGCAAGCTATTTTGTGG + Intergenic
1131320141 15:91381289-91381311 AACTTCAGCAAGTTGTTTTGTGG - Intergenic
1131353183 15:91720174-91720196 AATCTCAGCAATTAATTCTGTGG - Intergenic
1131904072 15:97122087-97122109 AATTCCAGGGAGTTATTTTGTGG + Intergenic
1132123015 15:99194215-99194237 AATCTCAGGAAGTTATTTTGTGG + Intronic
1132126202 15:99227420-99227442 AATCCTGGCAAGTAATTATGAGG - Intronic
1132255935 15:100375701-100375723 AATCTCAGCAAGTTATTTTGTGG - Intergenic
1133491343 16:6272549-6272571 AATCCCGGTAAGCTTTTTTGTGG + Intronic
1133665646 16:7965275-7965297 AATCCCAGTAATATATTTTATGG + Intergenic
1134875492 16:17694717-17694739 AATCTCAGAAAGCTATTTTGAGG - Intergenic
1135273736 16:21092076-21092098 AATCCCAGCAAGTTATTTTGTGG + Intronic
1135433750 16:22410607-22410629 AATCCCCATAAGTTATTTTTTGG - Intronic
1135462004 16:22652586-22652608 AATCCCAGCAACTTTTTGGGAGG + Intergenic
1136668248 16:31833325-31833347 AATAAAAGCAAGATATTTTGTGG - Intergenic
1137367659 16:47874547-47874569 AATGCCAGTAACTGATTTTGTGG + Intergenic
1137628579 16:49925355-49925377 AACTCCAGCAAGTTATTTTATGG + Intergenic
1138176605 16:54905260-54905282 AATCCCATCAAGTTATTTTGTGG + Intergenic
1138355682 16:56378056-56378078 TATCCCAGCAAGCTATTTTGTGG + Intronic
1138792959 16:59929908-59929930 ATTCTCACCAAGTCATTTTGTGG + Intergenic
1138904916 16:61319663-61319685 AATCCCAGCAAGTTATTTTGTGG + Intergenic
1138967638 16:62104606-62104628 AATCCTAGCAACTTTTGTTGTGG - Intergenic
1139121821 16:64028152-64028174 AAGTCCAGCAAGTTATTTTGTGG - Intergenic
1141194247 16:81847965-81847987 AATCCCAGCAAGTTATTCTGTGG + Intronic
1141823732 16:86464925-86464947 CATCCCAGGAAGTAATTTGGGGG - Intergenic
1144027986 17:11295613-11295635 AGTCCTAGCAAGCCATTTTGAGG + Intronic
1144048460 17:11474876-11474898 AATCCCACCAAGTTATTTTGTGG - Intronic
1144140210 17:12340822-12340844 ACTCCCAGCAAGATATACTGAGG - Intergenic
1144226406 17:13152362-13152384 AATTCTAGCAAGTTATTTTATGG - Intergenic
1145229114 17:21158656-21158678 AATCCCAGCAAGTCATTTTATGG + Intronic
1146554101 17:33808555-33808577 AATCCCATTAAGTTATTCTGTGG - Intronic
1146702761 17:34975947-34975969 AATTCCAGTAACTTAGTTTGTGG + Intronic
1147354193 17:39880043-39880065 GCTCCAAGCAAGTTATTTTGTGG - Intergenic
1148119538 17:45200042-45200064 AATCCCAGCAAGCACTTTGGGGG - Intergenic
1148761316 17:50002751-50002773 AATCTCAGAAAGTTCTTTTGTGG + Intergenic
1149106749 17:52976907-52976929 AATTCCAGCAAGTTATTTTGTGG - Intergenic
1149508779 17:57219286-57219308 AATTCCAGCATGTTATTTTGTGG + Intergenic
1149803107 17:59589186-59589208 AAGTTCAGCAAGTTATTTTGTGG - Intronic
1149843380 17:59986298-59986320 AAGTTCAGCAAGTTATTTTGTGG + Intergenic
1149939721 17:60850920-60850942 AATACAAGCAAGTTATTTTGTGG + Intronic
1150014908 17:61544586-61544608 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1150779442 17:68108809-68108831 ACTCCCAGCTAATTTTTTTGGGG + Intergenic
1152063151 17:78094289-78094311 TATCACAGCATGCTATTTTGTGG + Intronic
1152385590 17:79972432-79972454 AATCCCAGCACTTTTTTTTTGGG - Intronic
1153036517 18:768304-768326 AATCCCAGCAGGCATTTTTGTGG - Intronic
1153118945 18:1696709-1696731 AATCTCAGCAAGTTATTTTGTGG - Intergenic
1153404837 18:4725946-4725968 AATCCTAGCAAATTATTTTTTGG + Intergenic
1153792511 18:8592512-8592534 AATCACAGCAAGTTATTTTGTGG + Intergenic
1153876393 18:9376249-9376271 AATCCTAGCAATTTATCTTATGG + Intronic
1154077835 18:11222372-11222394 AATTCCAGCAAGCTATTTTGTGG + Intergenic
1154088485 18:11332150-11332172 AATCTCAGCAAGTTACTTTGTGG - Intergenic
1154319390 18:13333930-13333952 AATCCCAGCAAGTTATTTTGTGG - Intronic
1154337686 18:13478738-13478760 AATCCCAGTGAGTTGTTTTTTGG + Intronic
1154345072 18:13535807-13535829 GATCCTATCAAGTTAATTTGTGG + Intronic
1154404756 18:14079374-14079396 AATTCCAGGAACTTATTTTGTGG + Intronic
1154487486 18:14885345-14885367 AAGCCCTGCAAGTCATTCTGAGG + Intergenic
1154951316 18:21212855-21212877 AATCCCAGAAAATTATTTTGTGG - Intergenic
1155124923 18:22864163-22864185 AATCCCAGAAAGTTATTTTGTGG - Intronic
1155374213 18:25138303-25138325 AATATCGGAAAGTTATTTTGAGG + Intronic
1155593149 18:27451839-27451861 AATCTCAGCAACTTATTTTGCGG - Intergenic
1155620886 18:27778211-27778233 AATACAAGCAAATAATTTTGAGG - Intergenic
1155781520 18:29842875-29842897 AATTCCAGCAAGTTATTTTGTGG - Intergenic
1156120841 18:33841171-33841193 GTTCCTAGAAAGTTATTTTGTGG - Intergenic
1156246141 18:35300512-35300534 AATCCCAGCAGGTCTTTTTTAGG - Intergenic
1156569061 18:38232137-38232159 AATCCCAGTAAGTTACTTTGTGG - Intergenic
1156896120 18:42247885-42247907 AATTCTATCAAGTTATTTGGTGG - Intergenic
1157292716 18:46421510-46421532 AATCCTAACAAGGCATTTTGTGG - Intronic
1157343159 18:46798439-46798461 AATCTCAGCAAGCTATTTTGTGG + Intergenic
1157896870 18:51477885-51477907 AATCAGAGCAAATTATTTTTTGG - Intergenic
1157964994 18:52198147-52198169 ATTCCTAGGAAGATATTTTGGGG + Intergenic
1158030371 18:52956625-52956647 AATTTCAGTAAGTTACTTTGTGG - Intronic
1158701033 18:59746969-59746991 AACCTCAGTGAGTTATTTTGTGG - Intergenic
1158783615 18:60681858-60681880 AATTCCAGCAAACTATTTTGTGG + Intergenic
1159176735 18:64846158-64846180 AATCATAGCAAGTTATTTTGTGG + Intergenic
1159487175 18:69077208-69077230 AATTCCAGCAAGTTATTTTGTGG + Intergenic
1159812523 18:73033227-73033249 AATCCTAGTAAGTTATTTTACGG + Intergenic
1160282528 18:77505333-77505355 AATCCCAGCAAAATATTTGTAGG - Intergenic
1160536232 18:79595295-79595317 AATTTCAGCAAGTTATTTTGTGG + Intergenic
1160561332 18:79758432-79758454 AATCCTAGCAAGTTATCTTGTGG - Intergenic
1161184786 19:2910000-2910022 AATCCCAGCAAGTTATTTGGTGG - Intronic
1161881967 19:6961409-6961431 ATTCCCAGAAAATTATTTTGTGG - Intergenic
1162789885 19:13057343-13057365 CATCCCAGCCAGTAATTTGGGGG - Intronic
1164005574 19:21145501-21145523 AAGCCCAGCTAGTTTTTTTCTGG + Intronic
1164387348 19:27784990-27785012 AATTCCACAAAGTTAGTTTGTGG + Intergenic
1164396640 19:27870292-27870314 AATCCCAACAAATTATTTCATGG + Intergenic
1164474049 19:28560408-28560430 AATCTCAACAAGTTATTCTCTGG - Intergenic
1165284036 19:34824001-34824023 AATACCAGCAAGTTACTTTGTGG + Intergenic
1165665454 19:37623598-37623620 AAACCCAGCAAGTTTTTATTAGG - Intronic
1165889914 19:39105386-39105408 AAGCACAGCGAGTTGTTTTGTGG + Intronic
1166800286 19:45452535-45452557 TAACCCTGCAAGTGATTTTGTGG + Intronic
1167804996 19:51775455-51775477 AATTCCAGCAATTTATTCTGTGG - Intronic
1167836270 19:52073847-52073869 AAACCCAGCAAGCTATATTTAGG + Intronic
1167841168 19:52122128-52122150 AAATCCAGCAAGTTATATTTAGG + Intronic
1168464536 19:56590756-56590778 AATCCCAGCAAGTTATTCTGTGG + Intergenic
925383012 2:3440221-3440243 AATCTCAGCAAATTATTTTGTGG - Intronic
925784203 2:7413308-7413330 AATCTTAGCAACTTATTTTGTGG - Intergenic
926262706 2:11281972-11281994 AACCCCAGTAAGTTATTTCACGG + Intronic
926499197 2:13632198-13632220 AATCTTAGCAAGTTACTTTGTGG + Intergenic
926835947 2:17020542-17020564 AATCTTGGCAAGTTACTTTGTGG - Intergenic
926947841 2:18207689-18207711 AGTCTCAGCAAGTTATTTTGTGG - Intronic
927877023 2:26664782-26664804 AATCCCAGCAAGTTATTTTGTGG - Intergenic
927902987 2:26835316-26835338 ATTACCAGCAAGTTATTCTGTGG + Intergenic
928191253 2:29171127-29171149 AATCCCAGCAAGTTATTTTATGG - Intronic
928452741 2:31391531-31391553 AATCCCAGTAAATTATTTTGTGG - Intronic
928524267 2:32123493-32123515 AACCCCAGCCAGTTATTTTGTGG + Intronic
928567011 2:32563106-32563128 AACCCCAGCAAGTTATTTTGTGG - Intronic
928801374 2:35097772-35097794 CATCTCTGCAAGTTATTTTAGGG - Intergenic
929421751 2:41797790-41797812 AATCCTTGCAAATTATTTTGTGG - Intergenic
930331546 2:49991703-49991725 AATCCTGGCAAGTTATTTTGTGG + Intronic
930443254 2:51436374-51436396 AATCTCAGCAGGTTATTCTGTGG + Intergenic
930810982 2:55540619-55540641 AATTTCAGCAAGTTATTTTGTGG - Intronic
930843060 2:55869867-55869889 AATCTCAGCAAGTTCATTTTAGG - Intronic
931128999 2:59311967-59311989 AATCTCAACAAGATATTTTGAGG - Intergenic
931804613 2:65791915-65791937 AATGCTGGCAAGTAATTTTGTGG + Intergenic
931844046 2:66184432-66184454 GATCCCAGCAAATTATGTTTTGG + Intergenic
932470836 2:71955111-71955133 AATTCTAGTAAGTTATTTTGTGG - Intergenic
932483309 2:72063287-72063309 AGTCCCAAAGAGTTATTTTGTGG - Intergenic
932982227 2:76683159-76683181 GATCCCAACAAGTTATTTTGTGG - Intergenic
933185443 2:79273394-79273416 AATGAAAGCAAGATATTTTGTGG - Intronic
933399209 2:81770542-81770564 AATCTCAGCAATTTAGTTTATGG - Intergenic
933399311 2:81772360-81772382 AATCTCAGCAATTTAGTTTATGG - Intergenic
933529863 2:83494670-83494692 AATCCAAGCAAATTATTTTGTGG + Intergenic
933630988 2:84657356-84657378 AATTCCAGCAAGTTACTTTGTGG - Intronic
933661808 2:84933782-84933804 AAGGCTGGCAAGTTATTTTGTGG + Intergenic
933853342 2:86389005-86389027 AATCTTAGTAAATTATTTTGTGG - Intergenic
933854818 2:86402940-86402962 AATCCCTGAAACTCATTTTGTGG - Intergenic
933864350 2:86502215-86502237 AAACCCAGCAAAGTATTTTGTGG + Intergenic
934484055 2:94685559-94685581 AATCCTATCAAGTTGTTTTTTGG + Intergenic
934602071 2:95665311-95665333 CATCCCAGAAAGTTCTCTTGTGG + Intergenic
934612275 2:95749586-95749608 AATCTTAGCAAGGTATTTTCTGG + Intergenic
934841877 2:97629862-97629884 AATCTTAGCAAGGTATTTTTTGG - Intergenic
935043472 2:99457349-99457371 AATCCCAGCAAGGTATTTTGTGG + Intronic
935440308 2:103086587-103086609 AGTCTCAGCAAGTTATTTTGTGG + Intergenic
935506389 2:103909659-103909681 AGTCACTGCAAATTATTTTGTGG - Intergenic
935510692 2:103969480-103969502 CATCCCAGCAGGCTATTTTATGG - Intergenic
935750435 2:106228097-106228119 AATCTCAGCAAGTTGTTTTGTGG - Intergenic
935824026 2:106924570-106924592 AATCACAGCAAGTTACTTTGTGG - Intergenic
935875940 2:107507809-107507831 AATCTCAGCAAGTTACTTTGTGG - Intergenic
936120832 2:109742634-109742656 AATCTCAGCAAGTTGTTTTGTGG + Intergenic
936223865 2:110628839-110628861 AATCTCAGCAAGTTGTTTTGTGG - Intergenic
936535425 2:113307466-113307488 CATCCCAGAAAGTTCTCTTGTGG + Intergenic
936682665 2:114792387-114792409 AATCCTAGAAAGATATTTGGAGG - Intronic
936838393 2:116737450-116737472 AACCCAAGCAAGATATTTTGTGG - Intergenic
936838934 2:116745260-116745282 AACCCAAGCAAGATATTTTGTGG + Intergenic
936942028 2:117893706-117893728 AACTCCAGGAAGTTATTTTGTGG - Intergenic
937513013 2:122619746-122619768 AATAAAAGCAAGATATTTTGTGG - Intergenic
937542688 2:122978504-122978526 AATCCCAGCGAGTTATTTTGTGG + Intergenic
937843345 2:126550198-126550220 AACCACAGCAAGTTATTTTGTGG + Intergenic
937845965 2:126579218-126579240 ACTCCAGGGAAGTTATTTTGAGG - Intergenic
937850653 2:126631315-126631337 AATCCCAAGATGCTATTTTGTGG + Intergenic
937957880 2:127432295-127432317 AATCCCAGTATGTCTTTTTGTGG + Intergenic
938198110 2:129350053-129350075 AATCCCTGCAAGCTATTCTGTGG - Intergenic
938836547 2:135109204-135109226 AATCTCAGCAAGTTATCGTGAGG - Intronic
939144353 2:138394886-138394908 AATTCTAGCAAGTTATTTTGTGG + Intergenic
939401038 2:141694175-141694197 AATCCCAATATGTCATTTTGTGG - Intronic
940371750 2:152909748-152909770 AGTTCCAGCAAGTTACTTTGTGG - Intergenic
940372211 2:152916249-152916271 AATCCCAGCAAGTTAGGCTTTGG + Intergenic
940410152 2:153352982-153353004 AATCCCAGCAAGTTATTTTGTGG - Intergenic
940620237 2:156103295-156103317 AAATCCAGAAAGTTATTTTGTGG + Intergenic
940819285 2:158333958-158333980 AATCCCAGCAAATTATTTTTTGG - Intronic
940878982 2:158927032-158927054 AATCACAGCAAGTTATTTTGTGG - Intergenic
940995718 2:160147444-160147466 AATGCCATCAAATTATTTTGTGG + Intronic
941402861 2:165053007-165053029 AATCCCTGCGAGTTATTTTGTGG + Intergenic
941474685 2:165935926-165935948 AATCCCAGCAAGTTATTTTGAGG + Intronic
941603727 2:167569249-167569271 AACCCTAGCAACTTATTTTATGG - Intergenic
941613263 2:167687957-167687979 AATCCCAGCTAATATTTTTGAGG + Intergenic
942961561 2:181835490-181835512 AATAACAGCAAGTAATTTTACGG - Intergenic
943210657 2:184961625-184961647 ACTCCCAGCAAGCTAGTTTGTGG - Intergenic
943292023 2:186085627-186085649 ATTCTCAAGAAGTTATTTTGGGG - Intergenic
943301630 2:186209966-186209988 AATCTCAGTGAGTTATTTTATGG - Intergenic
943341702 2:186690267-186690289 TAATCCAGCAAGTTATTTTCAGG - Intergenic
943464680 2:188214593-188214615 AATTCTAGCAGGTTATTTTGTGG - Intergenic
943606586 2:189983936-189983958 AAAACCAGCAAGTTTTTTTTAGG + Intronic
943664754 2:190597452-190597474 TTTCCAAGAAAGTTATTTTGTGG - Intergenic
943702559 2:191002536-191002558 AATACCAACAAGTTGTTTTCTGG - Intronic
943710447 2:191088548-191088570 AATACTAGCAAGTTATTTTCTGG + Intronic
943822419 2:192342739-192342761 AACCCCAGAAAGTTATTTTGTGG - Intergenic
944021579 2:195112059-195112081 AAGCCCAGCAACTCATTTTTTGG - Intergenic
944341679 2:198608779-198608801 AATCTCAACAAGTAATGTTGAGG + Intergenic
945403354 2:209416035-209416057 AATCTCAGCAAGTTACTTTGTGG + Intergenic
945723024 2:213442384-213442406 AATCCCAGCAAGTTATTTTGTGG + Intronic
945992830 2:216410902-216410924 AATCAAAGCAAGGTATTATGAGG - Intergenic
947043890 2:225955082-225955104 AATCCCAGCAAGTAATTTTGTGG + Intergenic
948546445 2:238733451-238733473 ATTCCCAGTGAGTTATTTTGTGG - Intergenic
948842450 2:240660399-240660421 AATCCCAGCAAGTAATTTTGTGG - Intergenic
1168761324 20:351796-351818 AACCCCAGCACGTTATTTTGTGG + Intronic
1169032932 20:2426044-2426066 AATCTGAAGAAGTTATTTTGTGG - Intronic
1169048043 20:2552299-2552321 AATCCCAGCAAATTATTCTGTGG - Intronic
1169106404 20:2999320-2999342 AATCCCAACAGGTTTTTTTGTGG + Intronic
1169643895 20:7787567-7787589 AATTTCAGCAAGTTATTTGGTGG + Intergenic
1170049090 20:12121663-12121685 AATCATAGGAAGTTATTTTATGG + Intergenic
1170355093 20:15483575-15483597 GATTCCAGCAAGTTATTTTGTGG - Intronic
1170378150 20:15725136-15725158 AATCTCAGCAAGCTATTCTGTGG - Intronic
1170722342 20:18894233-18894255 AATTCTATCAAGTTATTTTGTGG + Intergenic
1170740911 20:19055393-19055415 AATCCCAGTAAGGTATTTTGTGG + Intergenic
1170751536 20:19152274-19152296 AACCCCAGTAAATTATTCTGTGG + Intergenic
1170772475 20:19345363-19345385 AATCTCAGTAATTTATTTTGTGG + Intronic
1170783027 20:19443209-19443231 TATCATAGCAAGTAATTTTGTGG - Intronic
1170956721 20:20987542-20987564 AAATCTAGCAAGTTATTTTGTGG + Intergenic
1171432924 20:25096646-25096668 AATCCCAGCAAGTTGCTTTGTGG + Intergenic
1171467918 20:25344626-25344648 GATCCCAGCAAGTTATTTCCCGG + Intronic
1172616630 20:36291535-36291557 AATCCCAACAAGTTATTTGAGGG - Intergenic
1172900060 20:38328137-38328159 AGTCCCAGCAAGGGAGTTTGTGG + Intronic
1173680640 20:44878374-44878396 AATCCCAATGAGTAATTTTGTGG + Intergenic
1173887350 20:46471948-46471970 AATCCTAGCAAGCTTTTTTGTGG - Intergenic
1174084544 20:47997009-47997031 AATTCCTGCAAGTTATATTGAGG - Intergenic
1175865858 20:62176129-62176151 AATCCAAATAAGTTATTTTCAGG - Intronic
1176273715 20:64250960-64250982 AATCTCAGCAAGTTATTTCATGG - Intergenic
1176738630 21:10575925-10575947 CTTCCCAGCATGTTATTTTTTGG - Intronic
1176793793 21:13353989-13354011 AAGCCCTGCAAGTCATTCTGAGG - Intergenic
1177021671 21:15867967-15867989 AATTCCAGCAAGATGTTTTATGG + Intronic
1177058326 21:16337549-16337571 AATCTCAGCCACTTACTTTGTGG + Intergenic
1177349583 21:19919461-19919483 GATCTCAGAAAGTAATTTTGTGG + Intergenic
1177520855 21:22222782-22222804 AATTCTAGCAAGTTATTTTATGG - Intergenic
1177677013 21:24313796-24313818 AATCCCAGCAAATTATTTTGTGG + Intergenic
1177725764 21:24965468-24965490 AATTCTAGAAAGTCATTTTGTGG + Intergenic
1178047556 21:28712232-28712254 GATCCCAGGAAGTGCTTTTGAGG - Intergenic
1178381032 21:32108452-32108474 CATCCTAGCAAGTTATTTTGTGG + Intergenic
1178788694 21:35677845-35677867 AAGCTCAGCAAGTATTTTTGTGG - Intronic
1179078410 21:38145994-38146016 AACCCCAGGAAATTATTTTGTGG - Intronic
1182056667 22:27361610-27361632 AATCCCAGACAGTTATTTTGTGG - Intergenic
1183613997 22:38931051-38931073 AATGTCAGCAAGTTATTTTGTGG - Intergenic
1184888271 22:47361517-47361539 AATCCCAGCAAGTTATTTTAAGG - Intergenic
1185007011 22:48285313-48285335 AATTCTAGTATGTTATTTTGTGG + Intergenic
1185160302 22:49222623-49222645 AATCCCAGAAACTTATTTTGTGG + Intergenic
1185308428 22:50137203-50137225 AATTCCACCATGTTATTTCGGGG - Intronic
949292232 3:2480718-2480740 AATCCCAGAAAGGTATTTTGTGG + Intronic
949389872 3:3548385-3548407 AATCTTAGCAAGTTATTTTGTGG - Intergenic
949525118 3:4895627-4895649 AATCCCAGCTACTTACTTGGAGG + Intergenic
949902756 3:8832576-8832598 AATCCTGGCAAGGTATATTGTGG + Intronic
950222040 3:11203872-11203894 AATTCCAGCAAGTTATTTTGTGG - Intronic
950352146 3:12365931-12365953 AATCCCAGCAAGTTATTTTGTGG - Intronic
950731486 3:14963263-14963285 AACCTCAGAAAGTTATTGTGAGG - Intronic
950812471 3:15662153-15662175 AATCCCAGCAAGTTATTCTGTGG - Intergenic
950959118 3:17086053-17086075 AAATCCACCAAGTTATTTTGTGG + Intronic
951265917 3:20566619-20566641 AATCCTACCCAGTTATTTTCTGG - Intergenic
951446669 3:22789521-22789543 AATCCCAGAAAGTTATTTTGTGG + Intergenic
951465913 3:23000352-23000374 AATCCAAACAAGATATGTTGGGG - Intergenic
952128139 3:30327187-30327209 AATCTCAGCAAGTTATTTTATGG + Intergenic
952131108 3:30364464-30364486 AATCACAGTAAGTTTTTTTCCGG + Intergenic
952191947 3:31032684-31032706 AATCCCAGAAGGTTATTTTGTGG - Intergenic
952245689 3:31589006-31589028 TATCTCAGCAAGTGACTTTGTGG - Intronic
952299392 3:32090803-32090825 AATACAAGCAAGATATTTTGTGG + Intergenic
952361432 3:32633916-32633938 AGTCTCAGCAAGTTATTTTGTGG - Intergenic
952473265 3:33678881-33678903 ATTCCAGCCAAGTTATTTTGTGG + Intronic
952635971 3:35531841-35531863 AATTGCAGCAAGTTATTTTGTGG + Intergenic
952640251 3:35585304-35585326 AATCTCAGTAAGATATTTTGTGG - Intergenic
952703928 3:36357412-36357434 AACCTCAGCAAATAATTTTGTGG - Intergenic
952897028 3:38084641-38084663 AAGCCCAGCAAGTGACTTTGAGG - Intronic
953299644 3:41759595-41759617 AATCCCAACAGGGCATTTTGTGG + Intronic
953301607 3:41782429-41782451 AGTCACAGTAAGTTATTTTTGGG - Intronic
953318574 3:41951304-41951326 AATCCCAACAACTATTTTTGTGG + Intronic
953422735 3:42767548-42767570 AATCCCAGCAAATTACTGTATGG + Intronic
953600099 3:44354440-44354462 AATCCCAGCAAGTTAGTTTGTGG - Intronic
953615449 3:44486533-44486555 AATCTAAGCAAGTTATTTTATGG - Intergenic
953698712 3:45179776-45179798 AAGGCCAGCCAGTTATCTTGGGG - Intergenic
953873834 3:46652707-46652729 AATCCTAACAAGTTATTTTGTGG + Intergenic
955169987 3:56554234-56554256 AATCCCAGCAAGTTATTTTGTGG - Intergenic
955262884 3:57411792-57411814 AATCCCAGCAAGTTATTTTTTGG + Intronic
955661481 3:61304191-61304213 AGTCACAGCCAGTTGTTTTGAGG - Intergenic
956078616 3:65533591-65533613 AATTCTAGAAAGTGATTTTGAGG - Intronic
956299635 3:67757134-67757156 ATTCTCAGCAAGTTATTTTGTGG + Intergenic
956521106 3:70105321-70105343 AATCACAGACAGTTATTGTGTGG - Intergenic
958001735 3:87759362-87759384 AATCCCATCAAATTATTCTGTGG + Intergenic
958555330 3:95667481-95667503 AAGCACAGCTAGATATTTTGAGG + Intergenic
958700587 3:97583748-97583770 AATCCCAGCAAGTTACTTTGTGG + Intronic
958964106 3:100539063-100539085 AATCCCAGCAAGTTACTTTGTGG + Intronic
959039502 3:101404968-101404990 AATCCAATCAAGGTGTTTTGAGG - Intronic
959046674 3:101482526-101482548 AATCCCAGCAAGTTACTTTGTGG + Intronic
959168806 3:102818425-102818447 AACCCTAGCAATTTATTTTGTGG - Intergenic
959243214 3:103827391-103827413 AATCCCAGTAAGTTGTTTTGTGG + Intergenic
959380331 3:105633740-105633762 AATCCAAGGAACTCATTTTGTGG + Intergenic
959485040 3:106918505-106918527 AATCCCAGCAAATTATTGTGTGG - Intergenic
959852310 3:111103175-111103197 AATCTCAGCAAGTTATTTTGTGG - Intronic
960020375 3:112945184-112945206 AATCTCAGCAAGTTATTTTATGG + Intronic
960213599 3:115001859-115001881 AATCCCACAAAGTTATTTTGTGG + Intronic
960220561 3:115103312-115103334 AATCCCAGAAAGTTATTTTGTGG + Intronic
960227134 3:115181535-115181557 AATCCCATCAAGTAATTTTGTGG + Intergenic
960341682 3:116482278-116482300 AATCCTAGCAAGTTATTTTGTGG + Intronic
960822968 3:121753772-121753794 AATCTTAGCACATTATTTTGTGG + Intergenic
961341890 3:126229567-126229589 AATCCCAGCTACCTATTTAGTGG - Intergenic
961743646 3:129049324-129049346 AATTCCAGCAAGTTACTTTGTGG + Intergenic
962000676 3:131292442-131292464 AATCCCAGCAAGTTACTTTGTGG - Intronic
962032868 3:131619814-131619836 AATACGATCAAGTCATTTTGGGG + Intronic
962166260 3:133052023-133052045 AATCCCAGCAAGTTATTTTGTGG - Intronic
963768087 3:149359307-149359329 AATCCCAGCAAGTCATTTTATGG - Intergenic
963845745 3:150155667-150155689 AATCCCAGCAAGTTATTTTGTGG + Intergenic
964086077 3:152820068-152820090 AACCTCAGCAAGTAATTTTGAGG - Intergenic
964267686 3:154918475-154918497 TATCCAACCAAGTTACTTTGTGG + Intergenic
964278122 3:155030340-155030362 AATCCCAGAAAGTCATATTTTGG + Intronic
965269362 3:166593238-166593260 AATCCTAGCAAGTTATTGTGTGG - Intergenic
965295831 3:166944733-166944755 AATAAAAGCAAGATATTTTGTGG + Intergenic
965460935 3:168962426-168962448 AACCCCAGCAAGTCATTCTGTGG - Intergenic
965802269 3:172506872-172506894 ATTCCCAGGAGTTTATTTTGCGG + Exonic
966275685 3:178164578-178164600 AATCTAAGTAAGTTACTTTGTGG + Intergenic
966535525 3:181029211-181029233 TTTACCAGCAAGTTATTTTGTGG - Intergenic
966545880 3:181147498-181147520 TATCCCAGTAAATTATTTTGTGG + Intergenic
966757776 3:183387638-183387660 ACACCCAGCCAGTAATTTTGAGG - Intronic
967308155 3:188079095-188079117 AATCGTAGCAAGTTACTTTGTGG + Intergenic
967369140 3:188723595-188723617 AACCCAAGTAAGTTATTTTCAGG - Intronic
967430368 3:189377555-189377577 AATCCTAGCAAGTTATTTTGTGG - Intergenic
967542880 3:190690047-190690069 ATTTTCAGCATGTTATTTTGAGG + Intergenic
968387293 4:152705-152727 AATCCCAGCACTTTGGTTTGTGG - Intronic
968444217 4:641065-641087 AATACCAGTAAGCTACTTTGTGG - Intronic
969629352 4:8326778-8326800 GACCCTAGCAAGTTATTCTGTGG - Intergenic
970229610 4:13895868-13895890 AATTCTAGCAAGTTATTTTGTGG - Intergenic
971917897 4:32897747-32897769 AATCCCTGCAAGTTATTTTGTGG - Intergenic
972448794 4:39175010-39175032 AATCCCAGCAAATTATTTTGTGG - Intergenic
972830087 4:42804482-42804504 AATACTAGAAAGTTATTTTGTGG - Intergenic
972835016 4:42860025-42860047 AATCCCAGCAGTTTTTTTTATGG - Intergenic
972915897 4:43879552-43879574 AATTCCAGAAAGTTATTGTGTGG + Intergenic
973135082 4:46697096-46697118 AATCCTAGCAAGTTATAATGTGG - Intergenic
973197381 4:47462013-47462035 GACACAAGCAAGTTATTTTGGGG + Intronic
973858870 4:55041147-55041169 AACCCCAGCAAGTTAGTATCTGG - Intergenic
974005777 4:56555490-56555512 AATCCTAGCAAGTTACTTCATGG - Intronic
974157209 4:58089525-58089547 ACTCTCAGCTATTTATTTTGGGG - Intergenic
974212479 4:58797320-58797342 ACTCCCAGCAAATTATTTTGTGG + Intergenic
974475016 4:62367329-62367351 AATCCCAGAAACATATATTGTGG + Intergenic
974854913 4:67449396-67449418 AATCTCAGCAAATCATTTTGTGG + Intergenic
975103562 4:70542423-70542445 AATCTCAGCAAGTTATTTTATGG + Intergenic
976090247 4:81449677-81449699 AATCTCAGCAAATGATATTGTGG - Intronic
976989487 4:91347498-91347520 AATCTCAGTGAGTCATTTTGTGG - Intronic
977374867 4:96189375-96189397 AATCCCAGAAAGTTATTTTGTGG - Intergenic
977616582 4:99093727-99093749 AATACCAGCAAATTATTTTGTGG + Intergenic
977822904 4:101496852-101496874 AATCCCAGCAAGTTATGTTGTGG + Intronic
977952024 4:102982433-102982455 AATTCCTGAAAGTTATTTTGTGG - Intronic
978242138 4:106528511-106528533 AATCCCAACAAGTTGTTTTATGG - Intergenic
978309708 4:107372954-107372976 AATCCCAGCAAGTTATTTTGTGG + Intergenic
978346026 4:107770513-107770535 AATCTCATCAAGTTATTTTGTGG + Intergenic
978415486 4:108471182-108471204 AATTCCAGCAAATTATTTGTGGG + Intergenic
978475271 4:109121063-109121085 AATCCCAGCAAGTTACTTTGTGG + Intronic
978665762 4:111179403-111179425 AATCCCAGCAAGTTATTTCGCGG - Intergenic
978832074 4:113099594-113099616 AATCTCAGCAAGTTGTCTTGTGG + Intronic
978905972 4:114006017-114006039 AATCACAGGAAGTCATTTTGTGG - Intergenic
979087582 4:116432667-116432689 ATGTCTAGCAAGTTATTTTGGGG - Intergenic
979493846 4:121362437-121362459 AATCCCAGCAAGTTATTTTCTGG + Intronic
979890855 4:126092185-126092207 AATTTAAGCAAGTAATTTTGTGG - Intergenic
979903364 4:126252303-126252325 AACCCCAGCAAGTTATTTTGTGG + Intergenic
979952598 4:126912756-126912778 AATCCCAGGAAATTATATCGTGG + Intergenic
980061012 4:128129515-128129537 AATCCCAGCAAATGATTTTGTGG + Intronic
980289011 4:130821115-130821137 AACCCCAGCAAGTTATTTTGTGG + Intergenic
980345209 4:131606693-131606715 AATCATAGCAAGTTTTTTAGAGG - Intergenic
980392173 4:132160770-132160792 AATCCTAGCATGTTACTTTTTGG - Intergenic
980442145 4:132863101-132863123 AATCCCAGAAAGTAATTTAGTGG + Intergenic
980609403 4:135137983-135138005 AATCCCAGAAAGTAATTTTGTGG + Intergenic
980702988 4:136457002-136457024 TATCCCAGTAAGTTAATCTGAGG - Intergenic
980930999 4:139182697-139182719 AATCCAATGAAGTAATTTTGAGG + Intergenic
981506756 4:145509456-145509478 AATACCCCCAAGTGATTTTGGGG + Intronic
982161173 4:152571022-152571044 AATCCCACCCAGTTATTTTATGG - Intergenic
982212179 4:153046887-153046909 TATCTCAGAAAGTTTTTTTGAGG + Intergenic
982213893 4:153063809-153063831 AATGAGAGCAAATTATTTTGGGG + Intergenic
982377032 4:154703814-154703836 AATCCCAGCAAGTTATTTGGAGG + Intronic
982406420 4:155025105-155025127 AAGAACAGCAAGTTAGTTTGAGG - Intergenic
982498224 4:156118954-156118976 AATCCCAGCAGGTTAGGTTCTGG - Intergenic
982666142 4:158266207-158266229 AATCCCAGCAATTTATTTTGTGG - Intergenic
982838962 4:160158249-160158271 AATCCCAGTACGTTATTTTGTGG + Intergenic
982861460 4:160455655-160455677 AATACTAGCAAATTGTTTTGTGG - Intergenic
982949313 4:161669261-161669283 AATTCCAGCAAGTCATTTTGTGG + Intronic
982978429 4:162098535-162098557 AACCCCAGAAAGTTATTTTGTGG + Intronic
983042410 4:162945238-162945260 AATCCCACTAAGTTATTCTCTGG + Intergenic
983093283 4:163532059-163532081 AATTCCAGCAAGTTATTTTATGG + Intronic
983109319 4:163728333-163728355 CATCCCAGAAAGTTATTTTTTGG - Intronic
983254968 4:165387922-165387944 AACCACAGCAAGAAATTTTGGGG - Intronic
983352415 4:166608503-166608525 AACACCAGCTAGTTATTTTGTGG + Intergenic
983571610 4:169214458-169214480 AATCCAAACAAGTTGTTTTGTGG - Intronic
983579754 4:169296477-169296499 AATCCAAATAAGTTGTTTTGTGG + Intergenic
983595164 4:169458018-169458040 CAACCCAGCAAGCTCTTTTGTGG + Intronic
983633614 4:169875799-169875821 AATCCCAACAAGACATTTTGGGG - Intergenic
983765771 4:171481056-171481078 AATCCCAACAGGCTATTTTGTGG + Intergenic
984298030 4:177879021-177879043 AATCTCAGCAAGTTCTTTCACGG - Intronic
984313561 4:178096692-178096714 AATCCCAGCATGCTATTCTGTGG + Intergenic
984413434 4:179426540-179426562 AATTTCAGGAAATTATTTTGAGG + Intergenic
985700051 5:1365771-1365793 AATCCTAGCAAGTTATTTTGTGG + Intergenic
987004967 5:13701121-13701143 AATCCCAGCCAGTTGTTCTCAGG - Intronic
987118559 5:14745556-14745578 AATCCCATAAATTGATTTTGGGG + Intronic
987239368 5:15978468-15978490 AATCTTAGTAAGTTGTTTTGTGG + Intergenic
987478667 5:18425347-18425369 AGTCATAGCAAGTTATTTTGTGG + Intergenic
987533572 5:19153277-19153299 AATCTCAGCAAGTGGGTTTGTGG - Intergenic
988243621 5:28647849-28647871 AATTCCATCAAGTTAGTTTTTGG + Intergenic
988720533 5:33873528-33873550 AATCTTAGCAATTTACTTTGTGG + Intronic
988820395 5:34878477-34878499 AATCTCAGCAAGTTATTTTTTGG + Intronic
988913745 5:35871782-35871804 AGTCCCTGAAATTTATTTTGGGG + Intronic
988937285 5:36097589-36097611 AATCTCAGCAAGTTATTTTGTGG - Intergenic
988965493 5:36412852-36412874 AGTCCCAGCAATTTCTTTTGTGG + Intergenic
989441020 5:41472430-41472452 AAACCCAGCAAGAGATTTTAAGG + Intronic
989515258 5:42336334-42336356 CATCTCAGCAGGTTGTTTTGTGG + Intergenic
990035612 5:51314863-51314885 AATCTCAGAAAGCAATTTTGTGG - Intergenic
990096981 5:52128125-52128147 AATCCCAGCAAGTTATTTTGTGG + Intergenic
990160467 5:52933782-52933804 AATCCCTACAAGTATTTTTGTGG + Intronic
990326683 5:54683651-54683673 AATCCCACCAAGTTATTCTGTGG - Intergenic
990407337 5:55504248-55504270 AATCCCAGCAACTTAGGCTGAGG + Intronic
990555113 5:56925715-56925737 AATCCCAGCAAGTTATTTTGTGG + Intronic
991054075 5:62303464-62303486 AATCACAGAAAGTTTTTGTGAGG - Intergenic
991528004 5:67584267-67584289 CATCTCAGCATGTTAGTTTGTGG + Intergenic
991561026 5:67953030-67953052 AATCTCAGCAAGTTATTTTACGG - Intergenic
992160247 5:73993929-73993951 AAACCCAGCAAGTTTTTATTAGG + Intergenic
992316161 5:75557358-75557380 AATCCCAGCAAGCTATTTTGTGG - Intronic
992537993 5:77731064-77731086 AATCTTAGCATGGTATTTTGAGG + Intronic
992601070 5:78400395-78400417 AATCCCAGCAAGTTATTTTGTGG - Intronic
992694267 5:79269465-79269487 AATCTCTGCAAGTTATTTTGTGG - Intronic
992828940 5:80575601-80575623 AATCCCAGCTGGTTTTTTGGAGG + Intergenic
993023515 5:82620467-82620489 CATTCCAGAAAATTATTTTGTGG + Intergenic
993100837 5:83538031-83538053 AATCACAGAAAGCTTTTTTGAGG + Exonic
993172861 5:84442516-84442538 AATCAAGGCAAGTTATTTTGTGG + Intergenic
993242011 5:85402344-85402366 AATTCCAGCCAGATATTTTGTGG + Intergenic
993294158 5:86112866-86112888 AATGCCAATAAGTTATTTTGTGG - Intergenic
993467034 5:88261371-88261393 AATCCAAGCAAGTTATTTTAAGG + Intronic
993473664 5:88336961-88336983 AATCCCAGCAAGGTTTCTTGTGG - Intergenic
993780275 5:92057963-92057985 TATCTTAGCAGGTTATTTTGTGG - Intergenic
993935839 5:94001175-94001197 AATCCCAGCAAGTTATTTTGTGG - Intronic
993992753 5:94679990-94680012 AAACCAAGTAAGTTTTTTTGTGG + Intronic
994004107 5:94817671-94817693 AATACAAGTAAGTTATTATGGGG + Intronic
994469369 5:100183154-100183176 AAACCCAGCAAATCATTTTCAGG + Intergenic
994513594 5:100741198-100741220 AATTCCAGCAAGTTACTTAGTGG - Intergenic
994943240 5:106351862-106351884 AATCTGAGTGAGTTATTTTGTGG - Intergenic
995257626 5:110065302-110065324 AATCACTGGAAGTTGTTTTGGGG - Intergenic
995285339 5:110382271-110382293 AATCTCAGAAAGTTATTTTGTGG - Intronic
995637949 5:114217213-114217235 AATCCTACTAAGTTATTTTGTGG + Intergenic
995656279 5:114430155-114430177 AATTACAGCAAGTTATTTTGTGG - Intronic
995671919 5:114614624-114614646 AATCCCAGCAAATTACTTTGTGG + Intergenic
996162959 5:120189355-120189377 AATCCCTGAAAATTATTTTTTGG - Intergenic
996233706 5:121100109-121100131 AATCCCATCAAATTATTTTGTGG + Intergenic
996456613 5:123691337-123691359 AATCCCAGCAAGCATGTTTGTGG - Intergenic
996913682 5:128685109-128685131 AATTCCAGGAAGTTAGTTTGTGG - Intronic
997054892 5:130430218-130430240 AATCACCCGAAGTTATTTTGTGG + Intergenic
997117455 5:131140548-131140570 AATCCAAGCAAGTTATTTTGTGG + Intergenic
997168785 5:131692515-131692537 AATCTCAGCAAGTTATTTTGTGG + Intronic
997641779 5:135453412-135453434 AATCCCAGCGAGTTATTTTGTGG - Intergenic
997730593 5:136170610-136170632 AATCCCTGCAAGCTATTTTTTGG - Intronic
997962588 5:138333880-138333902 AATCTCAGAAACTTATTTTTGGG - Intronic
998277601 5:140772267-140772289 AATGCCAGCAAGATTTTCTGTGG - Intergenic
998438167 5:142131635-142131657 ACTCCCAGGAAGTTATTCTATGG - Intronic
998942135 5:147296097-147296119 AATGCCAGCAAGGTATATTTTGG + Intronic
999564761 5:152845884-152845906 AATCCCAACAAATTGTTCTGTGG - Intergenic
1000238740 5:159388977-159388999 AACCACAGCAAGTTATTTTGTGG - Intergenic
1000733786 5:164872523-164872545 AATCCAAGCAAGTTATTTCATGG + Intergenic
1001457894 5:171880458-171880480 AATCCCAGCAAGTGATTTTGTGG - Intronic
1001462632 5:171931135-171931157 AAATCCAGCAAGTTACTTTGTGG + Intronic
1001538523 5:172519068-172519090 AATCCCAGCAAATTATTTTGTGG + Intergenic
1001968090 5:175928483-175928505 AATTTCAGCAAGTTATTTTGTGG + Intronic
1002249352 5:177915323-177915345 AATTTCAGCAAGTTATTTTGTGG - Intergenic
1002993713 6:2262815-2262837 AATTCCAGCAAGTTATTTTGTGG - Intergenic
1003854348 6:10257476-10257498 AATCTCTACAAGTTATTTTGTGG + Intergenic
1004033414 6:11896249-11896271 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1004112086 6:12728636-12728658 TAACCCAACAGGTTATTTTGAGG + Intronic
1004301252 6:14459948-14459970 AATCCCAGGAAGGTGTTTTGAGG - Intergenic
1004435905 6:15593727-15593749 AAGCAAAGCAAGTTGTTTTGAGG + Intronic
1004952157 6:20685529-20685551 AATCCCAGCAAGTTATTTTGTGG - Intronic
1005192129 6:23236128-23236150 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1005279291 6:24254921-24254943 AATCCCAGCAAGTGTTTTGGAGG + Intronic
1005520119 6:26593768-26593790 AATCCCAGCACTTTATATTCTGG + Intergenic
1005607299 6:27487460-27487482 AATACCAGCATGTATTTTTGTGG + Intergenic
1006074423 6:31521681-31521703 AACCTCAGTAAGTTATTTTGTGG + Intergenic
1006242961 6:32702357-32702379 AATGCCAAGACGTTATTTTGAGG + Intergenic
1007364395 6:41381136-41381158 AATCCCAGCAGGTTTGTTTTTGG + Intergenic
1007441389 6:41864070-41864092 AATCCCATCAAATTCTGTTGAGG - Intronic
1008531875 6:52468825-52468847 AGTCCCAGCAAGTGATTTTGGGG + Intronic
1008751658 6:54741011-54741033 AATCCTGGCAAATTAATTTGTGG - Intergenic
1008755665 6:54792913-54792935 AATCACAGCAAGTTATTTTTTGG - Intergenic
1008873067 6:56295472-56295494 AATCTCAACAAGTTACTTTGTGG - Intronic
1009293319 6:61911710-61911732 AATCACAGCATTTTAATTTGGGG - Intronic
1009480679 6:64154937-64154959 AATCACAGCCACCTATTTTGAGG + Intronic
1009544193 6:65003581-65003603 AAACCCAGCAAGTTTTTATTAGG - Intronic
1009688974 6:67001964-67001986 AATCCCAGCTAGTCATACTGTGG + Intergenic
1009737501 6:67696215-67696237 ATTCCTAGCAAGCTATTTTGTGG + Intergenic
1009798815 6:68506260-68506282 AATCCCAGCAATCTAGTTTTTGG - Intergenic
1011059805 6:83251836-83251858 AAATCCATCAAATTATTTTGAGG + Intronic
1011105469 6:83775568-83775590 GATCCTAGCAAGTTATTTTGTGG + Intergenic
1011238642 6:85246516-85246538 AATATCAGCAAGTTATTTTGTGG + Intergenic
1011257677 6:85440195-85440217 ATTCTCAGCAAGTTATTTTGTGG - Intergenic
1011265237 6:85510953-85510975 AATCCCAGTAAGTTGTTTTGTGG - Intronic
1011445901 6:87439105-87439127 AATTCCAGTAAGATTTTTTGGGG - Intronic
1011505105 6:88033201-88033223 AGTCCCAGCAAGTTACTTTGTGG - Intergenic
1011913908 6:92477786-92477808 AATCCCAGCAAGATATTGTGTGG + Intergenic
1011924889 6:92629720-92629742 AATCCTAGTATTTTATTTTGTGG - Intergenic
1012009426 6:93763156-93763178 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1012293415 6:97488525-97488547 AATCTGAGCAAGTTATTTTATGG - Intergenic
1012385471 6:98676754-98676776 AATCCCAGCAAGATATTTTGTGG + Intergenic
1012704407 6:102503187-102503209 AAAACCAGCAAGTTTTATTGAGG + Intergenic
1012704960 6:102512719-102512741 AATTTCAGCAGTTTATTTTGTGG - Intergenic
1012822185 6:104099833-104099855 AATCCTAGCAAGTTATTTTGTGG + Intergenic
1012925886 6:105267164-105267186 AATCCCAGAAACTTATTTTGAGG + Intergenic
1012936127 6:105369424-105369446 AATCCCAGAAACATATTTTGTGG + Intronic
1013238217 6:108217962-108217984 AATGTAATCAAGTTATTTTGTGG - Intronic
1013502229 6:110764217-110764239 AATCCCAGCCAACTGTTTTGTGG + Intronic
1013544448 6:111141910-111141932 AATCCCCGCTAGTTATTTTGTGG + Intronic
1013683799 6:112555001-112555023 AATACCAGTAAATTATTTTGAGG - Intergenic
1013720623 6:113023426-113023448 AATCCTATCAAGTTATTTTGTGG + Intergenic
1013882412 6:114920763-114920785 AATCTCAGCAAGTTATTTTGTGG - Intergenic
1013931195 6:115535314-115535336 AATTCCAGGAGCTTATTTTGTGG - Intergenic
1014178793 6:118360798-118360820 AATGCCAGCAAGTTATTTTGTGG + Intergenic
1014394646 6:120910912-120910934 AATCTCAGCAAGTTATTTGGTGG - Intergenic
1014546374 6:122741353-122741375 AGTCCCAGCAAATAATTTTTGGG + Intergenic
1014596355 6:123345587-123345609 AATTCTAGCAAGTTATCTTGTGG - Intronic
1014784647 6:125604498-125604520 AATCTCAGCAAACTATTCTGTGG + Intergenic
1014899742 6:126948012-126948034 AATCCCAGGAATTTTTTTTTTGG + Intergenic
1015080189 6:129214808-129214830 AATCCCAGCAAGTTATTTTTTGG - Intronic
1015095868 6:129415367-129415389 ATTCACTGCAAGTTATTTTATGG - Intronic
1015768256 6:136742107-136742129 AATCCCAGCAAGTTATTTGGTGG + Intronic
1015884956 6:137908362-137908384 AATTCCAGAAACTTATTCTGAGG - Intergenic
1016115516 6:140280207-140280229 AACCCCAGCAAGTTATTTTGTGG + Intergenic
1016169927 6:140999887-140999909 AATCCCAGTAAGTTGTTTTGTGG - Intergenic
1016222374 6:141691105-141691127 AATCTCAGCAAGTTATTTTATGG + Intergenic
1016255385 6:142098782-142098804 AATCCCAGAAAGGTAATCTGTGG + Intergenic
1016522903 6:144966521-144966543 CATCTCAGAAAGCTATTTTGAGG + Intergenic
1016716916 6:147244430-147244452 AATCCTAGCAAGCTATTGTGTGG - Intronic
1016955398 6:149621863-149621885 AATTCAGGCCAGTTATTTTGTGG - Intronic
1017031222 6:150224376-150224398 AATCCCAGGAAGCTGTTCTGTGG - Intronic
1017251757 6:152287879-152287901 AATTGCAGCAAGTTTTTTGGTGG - Intronic
1017621319 6:156301759-156301781 AAGCCCAGCAAGTTATTTTATGG + Intergenic
1017990533 6:159484491-159484513 CTTCCCAGCAAGTTGTTTAGTGG + Intergenic
1018097573 6:160404554-160404576 AATCCTACAGAGTTATTTTGTGG + Intronic
1018296849 6:162356579-162356601 AATCACATAAAGTTATTTTGAGG + Intronic
1018526743 6:164719315-164719337 AATTCCAGTAAGTTATTTTGTGG + Intergenic
1018565306 6:165145256-165145278 ATTCCCAGTAAGTCATTTTCTGG - Intergenic
1018602982 6:165565543-165565565 AATCCCAGGAAGTTATTTTGTGG + Intronic
1018693942 6:166374972-166374994 AATCCCAGCACGTTATTCTGTGG - Intronic
1018863289 6:167728172-167728194 AATCCCAGCAAGTTATTTTGGGG + Intergenic
1019413738 7:918043-918065 AATCCCAGCACTTTATATGGAGG - Intronic
1020075736 7:5257546-5257568 AATCCTAGCAAATTATTTTGTGG + Intergenic
1020154046 7:5707505-5707527 AATTCTAACAAGTTTTTTTGTGG + Intronic
1020587906 7:10094031-10094053 AATTCCAGTAAGTTAATTTGTGG - Intergenic
1020672404 7:11133166-11133188 ACTCTCAGCAAGTTATTTTGTGG + Intronic
1021012768 7:15492327-15492349 AACCCTTGCAAGTCATTTTGAGG + Intronic
1021036398 7:15804523-15804545 AATCTCAGCAAGCTATTTTTTGG + Intergenic
1021086530 7:16426780-16426802 AATACCAGCAAGTTATTTTGTGG - Intergenic
1021272015 7:18600798-18600820 AATTCCAGTAAGTTATTTGGTGG - Intronic
1021353493 7:19625568-19625590 AATCCCAGCAAGCAATTCTGTGG + Intergenic
1021481481 7:21122422-21122444 AATCCCATCCAGGGATTTTGGGG - Intergenic
1022075119 7:26961137-26961159 AATCCTGGCAAGTTATTTTGTGG + Intronic
1022420674 7:30219876-30219898 AATCTTAGCAAGTTAATTTGTGG + Intergenic
1022899835 7:34795865-34795887 TAACCCAGCAAGTTATTTTGTGG + Intronic
1023210586 7:37800025-37800047 AATTCCAGCAAGTTATTTTGTGG - Intronic
1023217577 7:37880668-37880690 AAGCCCAGCAAGTTATTTTGTGG - Intronic
1023229820 7:38015147-38015169 TATTCCAGCAAGCTATTTTGTGG - Intronic
1023425628 7:40032918-40032940 AATCCCAGCAAGTTATTGTGTGG - Intronic
1023434061 7:40124040-40124062 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1023444398 7:40216731-40216753 AATCCCAGCTACTCACTTTGGGG + Intronic
1023561925 7:41483958-41483980 AATCCCAGCAAGTTATTTTGTGG + Intergenic
1023597029 7:41840861-41840883 AATCTCAACTAGTTATTTTGTGG - Intergenic
1024059338 7:45686420-45686442 AATCCCAGCAAGCTGTTTTTGGG + Intronic
1024138719 7:46438931-46438953 AATCCCAGCAGATTTTTTAGTGG - Intergenic
1024160893 7:46674554-46674576 CATCACAGAAAATTATTTTGAGG + Intronic
1024166197 7:46733567-46733589 AATACCAGCAACTTATTTTATGG - Intronic
1024190789 7:47006824-47006846 ACTCCCAGAAATTTATTTTGAGG + Intergenic
1024220047 7:47280148-47280170 AATCTCAGCAACTTACTTTGAGG + Exonic
1024221329 7:47289855-47289877 AATCCCAGCAACTTATTTTGTGG + Intronic
1024225594 7:47324319-47324341 AGTGCCAGCAGATTATTTTGTGG - Intronic
1024690114 7:51791589-51791611 AATCCTAGCAAGTTATTTTGTGG + Intergenic
1024726333 7:52200768-52200790 AGTTCCAGCAAGTTATTTTGTGG + Intergenic
1024869407 7:53944740-53944762 AATCCCAACAAGTTAATCTGTGG - Intergenic
1024905935 7:54379924-54379946 AATCTCAGCAAAATGTTTTGTGG - Intergenic
1025203342 7:56976011-56976033 AATCCTAGCAAATTATTTTGTGG - Intergenic
1025291957 7:57735981-57736003 AATCTCAGTAAAATATTTTGTGG - Intergenic
1025668602 7:63600916-63600938 AATCCTAGCAAATTATTTTGTGG + Intergenic
1025712092 7:63921373-63921395 AATTCCACAAAGTTAGTTTGTGG + Intergenic
1027301563 7:76842555-76842577 AATCCTAGCAAGTTATGTTGGGG + Intergenic
1027582006 7:80009209-80009231 AATTCCAGAAACTTATTTTATGG + Intergenic
1027684251 7:81262550-81262572 AATCCAAGCAAGGTATTCTATGG - Intergenic
1027821532 7:83051665-83051687 AATCCCAGAAAGTTATTTTGTGG + Intronic
1028259532 7:88644503-88644525 AATCTTAGAAAATTATTTTGTGG + Intergenic
1028380020 7:90189628-90189650 AATCCCATCAAGATTTTTTATGG - Intronic
1028561017 7:92176118-92176140 AATCCAAGCAAGATACTTTGTGG - Intronic
1028808010 7:95051508-95051530 AATCTCAGAAAGTTATTTTGTGG - Intronic
1028926620 7:96363934-96363956 AATCCCAGGAGGTTATTTTGTGG - Intergenic
1028926625 7:96364059-96364081 AATCCTAGCAAGTTATTTTGTGG - Intergenic
1028940327 7:96514874-96514896 AATCCCAGCAAGTTATTTTGTGG + Intronic
1029017188 7:97326654-97326676 AATGCCAGGAAGTTATATTTTGG + Intergenic
1030180155 7:106698820-106698842 AATCTCAGCAAGTTATTGTGTGG - Intergenic
1030790426 7:113720441-113720463 GATCCCAGCAAGTTATTTTGTGG + Intergenic
1030826489 7:114165729-114165751 AATCCCAGCAAGTTATTTTGTGG + Intronic
1030873497 7:114785899-114785921 AATGCCAGAAGGTGATTTTGAGG - Intergenic
1031023212 7:116650716-116650738 AATCCCAGGATCTTATTTTAAGG - Intergenic
1031192781 7:118575935-118575957 AATCCAAGCAAGAGATGTTGAGG + Intergenic
1031408750 7:121417455-121417477 AATATCAGCAAGTTATCTTGTGG - Intergenic
1032178592 7:129654983-129655005 AATCCCAGCAAGTTATTTTGTGG - Intronic
1032365919 7:131299944-131299966 AATAAAAGCAAGATATTTTGTGG + Intronic
1032477375 7:132221425-132221447 ACTCCCATCAAGTTATTTGCAGG + Intronic
1032771043 7:135056847-135056869 AATCCCAGAAAGTTATTTTGTGG + Intronic
1032877604 7:136054245-136054267 AAGGCCAGCAAATTGTTTTGTGG + Intergenic
1033475902 7:141692247-141692269 AATCCCAGCAAATTATTTTGCGG + Intronic
1033826876 7:145201902-145201924 AATTCCAGCAAGTTATTTTGTGG - Intergenic
1035114177 7:156508786-156508808 AATCTCACCAATTTATTATGAGG + Intergenic
1035149720 7:156859761-156859783 AATCCCAGTAAATTATTTTCTGG + Intronic
1035340942 7:158161183-158161205 AATCCCAGCAAGTCATTTTTTGG + Intronic
1035356983 7:158281829-158281851 AAACCCTGCTAGTTCTTTTGAGG + Intronic
1035576687 8:712175-712197 TATCCCAGCAAGTTATTTTGTGG - Intronic
1035595819 8:856837-856859 GATCCCAGCATGTTATTTTGTGG + Intergenic
1036056819 8:5264117-5264139 CATCCCTGCAAGTTATTTTGTGG + Intergenic
1036099592 8:5764156-5764178 AATCTCAGTGAGTTATTTTGTGG + Intergenic
1036666318 8:10744330-10744352 AATCTTAGTAAGTTACTTTGTGG + Intronic
1037120223 8:15275891-15275913 AATCCCTGCAAGTTATTTTGTGG + Intergenic
1037622920 8:20582718-20582740 AATAAAAGCAAGATATTTTGGGG + Intergenic
1037731452 8:21527361-21527383 AATCCCATCAACTTGCTTTGTGG + Intergenic
1037852357 8:22342274-22342296 AATCCCAGCAAGTTATTTTGTGG + Intronic
1037979823 8:23244666-23244688 AATCATGGCTAGTTATTTTGTGG - Intronic
1038025734 8:23588193-23588215 AGTCTCAGCAAGTTATTTTGTGG - Intergenic
1038183804 8:25253858-25253880 AATCCCAGACAGTTATTTTGTGG + Intronic
1038273014 8:26091823-26091845 AAACCAAGTCAGTTATTTTGTGG + Intergenic
1038377537 8:27057539-27057561 AATCCAAGTAAGTTATTTTGTGG + Intergenic
1038728916 8:30109039-30109061 AATCCCAGCACTTTTTTTCGGGG - Intronic
1038752507 8:30309116-30309138 AATTCCAGCAGGTTATTTTGTGG - Intergenic
1039226215 8:35391328-35391350 AAGCCAAGCAAATTATTTTTTGG + Intronic
1039312698 8:36335933-36335955 AATCTCAGCAAGTTATTTTGTGG + Intergenic
1039624425 8:39032957-39032979 AATCCCAGCAAATTAGTTTGTGG - Intronic
1039631041 8:39111392-39111414 AATCTAAGCAAGCTATTTTGTGG - Intronic
1039643279 8:39248218-39248240 AATCCCAGCAAGGTGTTCTGTGG - Intronic
1039782735 8:40802674-40802696 AATCTGAAAAAGTTATTTTGTGG + Intronic
1039924878 8:41920662-41920684 AATCCCAGCAAGGTATTTTGTGG + Intergenic
1040353296 8:46589852-46589874 AAAACCAGCAAGTTATTATTAGG - Intergenic
1040469125 8:47721909-47721931 AATCTCATCAAGTTATTTTGTGG - Intronic
1040592600 8:48807713-48807735 AACCCCAGCGAGTTATTTTGTGG - Intergenic
1041132630 8:54718181-54718203 AATTCCAGCAAGCTATTTTGTGG + Intergenic
1041502197 8:58551546-58551568 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1041514932 8:58690070-58690092 ATTCCCAGCTAGATATTTGGTGG - Intergenic
1041892303 8:62883089-62883111 AATCCCAGAAAGTTATCTTGTGG - Intronic
1042072558 8:64952227-64952249 AATCTCAGAAAGTTACTTTGTGG + Intergenic
1042292788 8:67187181-67187203 AATCCCAGCAAGTTATTATGTGG + Intronic
1042366662 8:67944979-67945001 AATCCCAGCAAGTTATTTTGTGG + Intergenic
1042383304 8:68144219-68144241 AATCCCAACAGGTTATTTCTTGG - Intronic
1042419598 8:68570061-68570083 GCTTCCAGCAAATTATTTTGAGG - Intronic
1042657922 8:71120678-71120700 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1042673812 8:71294700-71294722 AATCCCAGAAATTTACTTTGTGG + Intronic
1042778161 8:72458745-72458767 AATCCCAGAAAGTTAAATTGTGG - Intergenic
1043057992 8:75464582-75464604 AATCCCCTCAATTTATTTTTTGG + Intronic
1043234758 8:77849310-77849332 AATCCCAACAAGTTATTTTATGG - Intergenic
1043320403 8:78977756-78977778 AATCTAGGCAAATTATTTTGTGG - Intergenic
1043559259 8:81471172-81471194 AATCCCAGCTACTCACTTTGAGG - Intergenic
1043618226 8:82154561-82154583 AACCTCAGCAAGTTACTTTGTGG - Intergenic
1043687185 8:83101630-83101652 AAACCCAGCAAGCTTCTTTGTGG - Intergenic
1043793830 8:84510035-84510057 AATTCCAGGAAATTACTTTGTGG - Intronic
1044023694 8:87140317-87140339 TATCTCTGCAATTTATTTTGTGG - Intronic
1044050488 8:87496284-87496306 CATCCCAGCAAGTTGTTTTATGG - Intronic
1044078242 8:87850741-87850763 AATTCCAGCAATTTGTTTTGTGG + Intergenic
1044750152 8:95408037-95408059 AATCCCAGCAATTTCTGCTGAGG + Intergenic
1044789318 8:95831091-95831113 AATCCTAGCAAGTTACTTTGTGG + Intergenic
1045090475 8:98738142-98738164 AAACCCAGCAAGACTTTTTGTGG + Intronic
1045400765 8:101815080-101815102 ATTTCCAGCATGTTATTTAGTGG + Intronic
1045996026 8:108363006-108363028 AATCCCAGCAAGTTATTTTGTGG - Intronic
1046024115 8:108701866-108701888 AATCCCAAGAAGCGATTTTGTGG + Intronic
1046228924 8:111327217-111327239 AATTCCAACAAGTTAATATGTGG + Intergenic
1046490504 8:114946378-114946400 AATCACAGCAAGTTATTTTGTGG - Intergenic
1047086366 8:121520987-121521009 AATCCCAGCATTTTGTTTTGTGG + Intergenic
1047651138 8:126923292-126923314 AATCTTAGCAACTTATTTTGTGG - Intergenic
1047660668 8:127032437-127032459 AATCCCAGGAAGTTATTTTGTGG + Intergenic
1047777088 8:128081236-128081258 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1047867097 8:129037227-129037249 AATCCTAGCAAGTTATTTTGTGG + Intergenic
1048239160 8:132723994-132724016 AAAACCAGCAAGTTTTATTGAGG + Intronic
1048575154 8:135684300-135684322 AATCCCACCATGTTATTTTATGG - Intergenic
1049829167 8:144688846-144688868 AATTCCAGCAAGATTTTTTGAGG + Intergenic
1049837352 8:144745529-144745551 AAACTCAGCAGGTTATTCTGTGG - Intronic
1050440157 9:5653454-5653476 ATTCCCAGCAATTTATTTTCTGG - Intronic
1050854493 9:10335050-10335072 AACCCCAGCCAGTTATATTTTGG + Intronic
1050961032 9:11731588-11731610 AATCACTGCTAGTTATTTTGTGG - Intergenic
1051002367 9:12299463-12299485 AATCCCAGAAAATTATTTTGTGG - Intergenic
1051442383 9:17099469-17099491 ACTCACAGCAAGTTATTTTGTGG - Intergenic
1052148656 9:25083360-25083382 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1052393788 9:27913060-27913082 AATCCCAGCAAGTCATTTTGTGG - Intergenic
1052639775 9:31152273-31152295 AATCCCAACAAGTTATTTTGTGG + Intergenic
1052665530 9:31490381-31490403 AATCACAGCAAGTTATTTTGTGG - Intergenic
1052809951 9:33049082-33049104 AATCCCAGCAAATTATTTTGTGG + Intronic
1052911262 9:33883998-33884020 AAGCCCAGCTAATTTTTTTGTGG - Intronic
1053364704 9:37514402-37514424 TATCCCAGCAGATTATATTGTGG - Intronic
1053543114 9:38994836-38994858 AATCCCAGCAAGTTATCTAGTGG + Intergenic
1053571029 9:39307340-39307362 AATTCCAGCAAATTATTAAGTGG + Intergenic
1053673728 9:40398831-40398853 AATCCTATCAAGTTGTTTTTTGG - Intergenic
1053807549 9:41818349-41818371 AATCCCAGCAAGTTATCTAGTGG + Intergenic
1053836914 9:42147948-42147970 AATTCCAGCAAATTATTAAGTGG + Intergenic
1053923530 9:43025191-43025213 AATCCTATCAAGTTGTTTTTTGG - Intergenic
1054092589 9:60866042-60866064 AATTCCAGCAAATTATTAAGTGG + Intergenic
1054114067 9:61141947-61141969 AATTCCAGCAAATTATTAAGTGG + Intergenic
1054126116 9:61311672-61311694 AATTCCAGCAAATTATTAAGTGG - Intergenic
1054384833 9:64538896-64538918 AATCCTATCAAGTTGTTTTTTGG - Intergenic
1054510899 9:65977459-65977481 AATCCTATCAAGTTGTTTTTTGG + Intergenic
1054593692 9:67040556-67040578 AATTCCAGCAAATTATTAAGTGG - Intergenic
1054623043 9:67369078-67369100 AATCCCAGCAAGTTATCTAGTGG - Intergenic
1055151060 9:73000362-73000384 AATTCCAGCAAGTTATCTTGTGG - Intronic
1055830415 9:80371871-80371893 AAAACCAGCAAGTTTTTTTAGGG + Intergenic
1056062605 9:82899430-82899452 AATCCCAGCATGTCCTCTTGCGG - Intergenic
1056427842 9:86495453-86495475 AATCTCAGCAAGTTATTCTGTGG - Intergenic
1056534093 9:87512757-87512779 AATCCCAGCTACTTACTCTGAGG - Intronic
1056614086 9:88147810-88147832 AATCCTAGAAAGCTACTTTGTGG + Intergenic
1056670068 9:88619734-88619756 AATCTCAGCAAGCTATTGTGTGG - Intergenic
1056686703 9:88770323-88770345 AATCCCAGAAAACTATTTTTTGG - Intergenic
1057098578 9:92335911-92335933 AATTCCAGCAAGTTACTTTCTGG - Intronic
1057137242 9:92701084-92701106 AATCAGAGCAAGTTATTTTGTGG - Intergenic
1057264675 9:93607233-93607255 AACCCCAGCAAGTTATTTTGTGG - Intronic
1057366376 9:94425374-94425396 ATTCTTCGCAAGTTATTTTGTGG + Intronic
1057508550 9:95657846-95657868 ACTCTCAGCAAGTTATTTTGTGG - Intergenic
1057656956 9:96962691-96962713 ATTCTTCGCAAGTTATTTTGTGG - Intronic
1057823742 9:98355686-98355708 AATCCCAGCAGATTATTTTGTGG + Intronic
1058201775 9:102051735-102051757 AAATTCAGCCAGTTATTTTGGGG - Intergenic
1058490797 9:105496422-105496444 AATCCCAGTAAGCTATTTTGTGG - Intronic
1058772681 9:108251976-108251998 AATCTCAGCAAGTTATCTTATGG - Intergenic
1058853406 9:109035531-109035553 AATCTCAGCAAGTTAATTTCTGG - Intronic
1059133093 9:111775559-111775581 AATCTCTGCAGGTTGTTTTGAGG + Intronic
1060234011 9:121848859-121848881 AATCCCAGCAAGTTATTTTGTGG + Intronic
1060320676 9:122556780-122556802 AACCCCAGCAAGTTACTTTGTGG - Intergenic
1060511839 9:124240205-124240227 AATCCCAGGCAGCTATTTTTGGG - Intergenic
1060884756 9:127143203-127143225 ACTCCCAGGAACTTATTCTGAGG - Intronic
1186294998 X:8139512-8139534 AATCCCATCAAGTACTTTTAAGG - Intergenic
1186710477 X:12190320-12190342 AATCCCAGGAAGTTATTTTGTGG + Intronic
1187335800 X:18380425-18380447 ATTCCCAGTCAGTTATTGTGTGG - Intergenic
1188038254 X:25342439-25342461 AATCCCAGAAAATTACTTCGTGG - Intergenic
1188114802 X:26229986-26230008 ATTCTCAGAAAGTTATTTTGTGG - Intergenic
1189527509 X:41840111-41840133 AATTTCAGGAAGTTACTTTGTGG - Intronic
1189891939 X:45611857-45611879 AATACCAGAAAGTTAATTTGTGG - Intergenic
1190084056 X:47380055-47380077 ATTCCCACCAAATTATTTTGTGG - Intronic
1190399488 X:50018003-50018025 AATTCCAGCAAGTTATTTTGTGG - Intronic
1190625456 X:52333699-52333721 AATCCCAACAGGTTATTTTGTGG - Intergenic
1190749622 X:53350380-53350402 AATCCCACTAAGTTATTTGTTGG + Intergenic
1190790249 X:53693174-53693196 AATCCCAGCAAGATCTTTTGTGG + Intergenic
1190854318 X:54278341-54278363 AATCCCAGCAAGGTTTTCTGTGG + Intronic
1190902046 X:54685290-54685312 AATCTCAGCATTTTATTTTATGG - Intergenic
1191684524 X:63876014-63876036 AATCCCAGCAAGTTGTTTTGTGG + Intergenic
1191923558 X:66283946-66283968 AATCCCATCAAGTTATTTTGTGG + Intergenic
1192102683 X:68281088-68281110 AATCCCAGCAAGTTATTTTGTGG + Intronic
1192187867 X:68965493-68965515 AATCTCATCAAGTTATTTTGTGG - Intergenic
1192540462 X:71965637-71965659 AATCCCAGCAAGTTATTTTGTGG - Intergenic
1192836665 X:74807071-74807093 AATCCCAGTAAGTTATTTTGTGG - Intronic
1192862532 X:75092035-75092057 AATCCCAGTAAGTAATTTTGTGG + Intronic
1192903788 X:75527570-75527592 AATCCCAGCAAATTACTTTGTGG - Intergenic
1193102463 X:77630353-77630375 AATCCCAGCTAGTTTCTTTGAGG + Intronic
1193399276 X:81022489-81022511 AATCTCACCAAGTTATTTTGTGG + Intergenic
1193552047 X:82906511-82906533 AATCCCAGAAAATTATTTTTTGG - Intergenic
1193864165 X:86709016-86709038 AATCCAAGGAAGTTGTTTTGTGG + Intronic
1194018300 X:88654534-88654556 AATGCCAACAAATTATCTTGCGG + Intergenic
1194064614 X:89246215-89246237 AATTTCAGGAAGATATTTTGTGG - Intergenic
1194077011 X:89407597-89407619 ATCCCCAGCCAGTTATTTTGTGG - Intergenic
1194094199 X:89617131-89617153 AGTCCCAGCAATTTATTTGGTGG + Intergenic
1194102636 X:89725211-89725233 AATTGCAGAATGTTATTTTGTGG - Intergenic
1194184355 X:90754967-90754989 AATCTTAGCAAGTTATTTCGTGG + Intergenic
1194205983 X:91011778-91011800 AATCTCTGCAAGTTATTTGGTGG - Intergenic
1194527315 X:94992874-94992896 AATCCCTGCCAGTTATTTCATGG - Intergenic
1194661342 X:96631208-96631230 AACCCAAGCAAGTTATTTTGTGG + Intergenic
1194844443 X:98787080-98787102 AATCCTAACATATTATTTTGAGG - Intergenic
1194864090 X:99044177-99044199 AATTCCAGCAAGTTATTTTGTGG - Intergenic
1195028589 X:100903948-100903970 AATCCCAGCAAATTATTTTGTGG + Intergenic
1195216392 X:102708160-102708182 AATCCCTGCAAGTTATGTTGTGG + Intergenic
1195583502 X:106534793-106534815 AATCCCAGTAAATAATTGTGTGG - Intergenic
1195633166 X:107081540-107081562 AATCCCAGAATGTTATTTTGTGG - Intronic
1195760410 X:108239915-108239937 AATACCAGCAGGATATTTTAAGG - Intronic
1195898074 X:109768980-109769002 AATCCCAGAGAGTTATGTTGCGG + Intergenic
1196000537 X:110779712-110779734 AATCCCAGCAAGTTATTTTGTGG - Intronic
1196541841 X:116919392-116919414 AAAACCAGCAAGTTTTTTTAAGG - Intergenic
1196609353 X:117693943-117693965 AATCCCAGCACATTATTTTGTGG - Intergenic
1196852659 X:119952721-119952743 AATCCCTGCAAATCATTTTGTGG - Intergenic
1197030777 X:121811774-121811796 AATCCCAGAAAGTTATTTTTTGG - Intergenic
1197341430 X:125271154-125271176 AATATCATCAAGATATTTTGTGG - Intergenic
1197486623 X:127059112-127059134 AATCCCAGCAACTTACTTAGTGG - Intergenic
1197665950 X:129223664-129223686 AATTCCACCAAGTTTATTTGGGG - Intergenic
1197948404 X:131866033-131866055 AATACAAGCATATTATTTTGTGG - Intergenic
1198136722 X:133759233-133759255 AATCCCTGCAACTTATTTTGTGG + Intronic
1198446399 X:136721103-136721125 AATCTCAGTAAGTTATTTTGTGG + Intronic
1198842555 X:140874184-140874206 AATCCTGGGAAGTTATTTTGTGG + Intergenic
1198932264 X:141873818-141873840 AATCCTAGCATGTTGTTTTGTGG + Intronic
1199062149 X:143370239-143370261 AGTTTCAGCCAGTTATTTTGTGG + Intergenic
1199292049 X:146115336-146115358 AAATCCCGGAAGTTATTTTGTGG - Intergenic
1199411254 X:147526466-147526488 AAACCCTGAAAGTTCTTTTGAGG + Intergenic
1200446830 Y:3273311-3273333 AGTCCCAGCGATTTATTTGGTGG + Intergenic
1200455222 Y:3382488-3382510 AATTGCAGAATGTTATTTTGTGG - Intergenic
1200530946 Y:4336894-4336916 AATCTTAGCAAGTTATTTCGTGG + Intergenic
1200551740 Y:4586586-4586608 AATCTCTGCAAGTTATTTGGTGG - Intergenic
1200718785 Y:6580293-6580315 AATTTCAGGAAGATATTTTGTGG - Intergenic
1200747656 Y:6916602-6916624 AATCCCAGCTACTTAGCTTGAGG + Intronic