ID: 1042657925 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:71120713-71120735 |
| Sequence | GCATTTAAACATATAGATCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1042657922_1042657925 | 12 | Left | 1042657922 | 8:71120678-71120700 | CCACAAAATAACTTGCTGGGATT | 0: 51 1: 140 2: 232 3: 229 4: 449 |
||
| Right | 1042657925 | 8:71120713-71120735 | GCATTTAAACATATAGATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1042657925 | Original CRISPR | GCATTTAAACATATAGATCA AGG | Intergenic | ||
| No off target data available for this crispr | |||||