ID: 1042657925

View in Genome Browser
Species Human (GRCh38)
Location 8:71120713-71120735
Sequence GCATTTAAACATATAGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042657922_1042657925 12 Left 1042657922 8:71120678-71120700 CCACAAAATAACTTGCTGGGATT 0: 51
1: 140
2: 232
3: 229
4: 449
Right 1042657925 8:71120713-71120735 GCATTTAAACATATAGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042657925 Original CRISPR GCATTTAAACATATAGATCA AGG Intergenic
No off target data available for this crispr