ID: 1042658451

View in Genome Browser
Species Human (GRCh38)
Location 8:71127384-71127406
Sequence TACTGTTGTCCCTCAATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042658449_1042658451 11 Left 1042658449 8:71127350-71127372 CCAAGGTAGTTAATGGATGTAAT No data
Right 1042658451 8:71127384-71127406 TACTGTTGTCCCTCAATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042658451 Original CRISPR TACTGTTGTCCCTCAATAGA TGG Intergenic
No off target data available for this crispr