ID: 1042660376

View in Genome Browser
Species Human (GRCh38)
Location 8:71148505-71148527
Sequence CTCAGGTTTCCCAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042660372_1042660376 7 Left 1042660372 8:71148475-71148497 CCAATCAGTTGAAGGTCTTAAGG No data
Right 1042660376 8:71148505-71148527 CTCAGGTTTCCCAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042660376 Original CRISPR CTCAGGTTTCCCAGAGAAGA AGG Intergenic
No off target data available for this crispr