ID: 1042666571

View in Genome Browser
Species Human (GRCh38)
Location 8:71213307-71213329
Sequence TAGGTTCTCAGAAAGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 286}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042666571_1042666573 2 Left 1042666571 8:71213307-71213329 CCTGCTTTCTTTCTGAGAACCTA 0: 1
1: 0
2: 3
3: 31
4: 286
Right 1042666573 8:71213332-71213354 CTCTACCCGCTTCTGTACTATGG No data
1042666571_1042666577 12 Left 1042666571 8:71213307-71213329 CCTGCTTTCTTTCTGAGAACCTA 0: 1
1: 0
2: 3
3: 31
4: 286
Right 1042666577 8:71213342-71213364 TTCTGTACTATGGGCTGCTTCGG No data
1042666571_1042666574 3 Left 1042666571 8:71213307-71213329 CCTGCTTTCTTTCTGAGAACCTA 0: 1
1: 0
2: 3
3: 31
4: 286
Right 1042666574 8:71213333-71213355 TCTACCCGCTTCTGTACTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042666571 Original CRISPR TAGGTTCTCAGAAAGAAAGC AGG (reversed) Intronic
902461285 1:16579127-16579149 TAGTTTCTCAGAGAGAAGACAGG + Intronic
902462069 1:16585423-16585445 TAGTTTCTCAGAGAGAAGACAGG + Intronic
902665367 1:17933999-17934021 CAGGTTCTCAGACAGAAGCCAGG + Intergenic
903742649 1:25567165-25567187 TTGGTTCTCAGAGAAAGAGCAGG - Exonic
906250323 1:44306176-44306198 AGGGTTTTCAGAAAGGAAGCAGG - Intronic
908482520 1:64556146-64556168 CACATTCTCAGGAAGAAAGCAGG + Intronic
909664373 1:78117217-78117239 TAGGTTCTAAGTAAGAATGCAGG + Intronic
910825056 1:91397972-91397994 CAGAATCTCAGAAAAAAAGCAGG + Intronic
911184796 1:94892693-94892715 AAGGTTCTCAGAAAGGGAGGTGG - Intronic
911219309 1:95230429-95230451 TGGGTTCCCATAAAGCAAGCTGG + Intronic
911561772 1:99415303-99415325 CAAGTTCTCAGAAGGAAAGCAGG - Intergenic
912800354 1:112715958-112715980 TGGGTTCTGAGAGAGAAAGGAGG - Intergenic
914364565 1:146966717-146966739 TAGTTTCTCAGAGAGAAGACAGG - Intronic
914365331 1:146973004-146973026 TAGTTTCTCAGAGAGAAGACAGG - Intronic
914487116 1:148120435-148120457 TAGTTTCTCAGAGAGAAGACAGG + Intronic
914940513 1:152018881-152018903 TAGTTTCTCAGAGAGAAGACAGG - Intergenic
916767952 1:167880071-167880093 TGTGTTTGCAGAAAGAAAGCTGG + Intronic
918462146 1:184787978-184788000 TAAGTTTTTAGAAAGAAAGGGGG + Intergenic
918823008 1:189283385-189283407 GAGGTTATCAGAAAGAAAATGGG + Intergenic
919216094 1:194557000-194557022 TAGGTTCACAGGAACAAAACTGG - Intergenic
920604950 1:207372049-207372071 TAGTTTCTTTGAAAGAAAGCTGG - Intergenic
921254248 1:213325206-213325228 TAGATGCTCAGAAAGAAAGCGGG - Intergenic
923488381 1:234458931-234458953 CAGACTCTCAGAAAGAAAGCAGG + Intronic
924572624 1:245251183-245251205 CAGATTCTCAGAAGGTAAGCAGG + Intronic
1063566433 10:7175297-7175319 AAGGTCATCAGAAAGAAAGAAGG + Intronic
1063799034 10:9550750-9550772 TAGATTCTCAGAAAGAGACAAGG + Intergenic
1064668706 10:17685761-17685783 TTGGGACACAGAAAGAAAGCAGG + Intronic
1064761039 10:18621131-18621153 TGGATTCTCAGAAGGAAAGCTGG - Intronic
1066995479 10:42559246-42559268 CAGATTCCCAGAAAAAAAGCAGG - Intergenic
1067053902 10:43040421-43040443 TGGGCCTTCAGAAAGAAAGCGGG + Intergenic
1069331172 10:67295280-67295302 AAAGGTCTCAGAAAGAAAGCAGG + Intronic
1070634330 10:78112051-78112073 TAGATTCTCAGAAAGCATTCTGG + Intergenic
1071416667 10:85448036-85448058 TAGGTGCTCAGAAACAGGGCAGG + Intergenic
1072404122 10:95133640-95133662 TAGGTCCTCTGAAAGAAAACTGG + Intergenic
1072718573 10:97767257-97767279 CAGGGTCTCAGAAAGTAGGCAGG - Exonic
1074139976 10:110663263-110663285 TATCTTCTCTGTAAGAAAGCAGG - Intronic
1074484967 10:113867085-113867107 CAGATTCTCAGAAGGAAAGCAGG + Intronic
1077693980 11:4376844-4376866 GAGGTACTCAGAAAAAAAGAAGG + Intergenic
1077971405 11:7195277-7195299 TAATTTGACAGAAAGAAAGCAGG + Intergenic
1078512922 11:11998907-11998929 GGGGAACTCAGAAAGAAAGCGGG - Intronic
1078560680 11:12368988-12369010 TAAGTGCCCACAAAGAAAGCAGG + Intergenic
1078921082 11:15831285-15831307 GAGGTCCGCAGAAAGAAGGCAGG - Intergenic
1079782644 11:24627516-24627538 TGGGATCACAGAAAGAAAGTCGG - Intronic
1081237138 11:40659356-40659378 TAGGTTCCCAGGCAGAAAGGAGG + Intronic
1082683174 11:56204896-56204918 TTGGATCTCAGAAAGAAATTTGG - Intergenic
1083536953 11:63478294-63478316 TTGGTTCTCAGAAAGAACAGTGG - Intronic
1086145185 11:83543973-83543995 CAGACTCCCAGAAAGAAAGCAGG - Intronic
1087788970 11:102387088-102387110 CAGTTTCTCAGAAAGAAAATAGG + Intergenic
1089458082 11:118636997-118637019 TAGGGTCTGAGGATGAAAGCTGG - Intronic
1094152981 12:27306657-27306679 TAGCTTCCCTTAAAGAAAGCAGG + Intronic
1094728774 12:33151093-33151115 TAGGGTCTCCGCAACAAAGCTGG - Intergenic
1095589996 12:43892407-43892429 CAGGCTCCCAGAAGGAAAGCAGG + Intronic
1096147498 12:49289334-49289356 TAGGGACTCAAAAATAAAGCTGG + Intergenic
1096189022 12:49602903-49602925 TAGGTTCTGAGGAACAAAGCTGG - Intronic
1096398018 12:51281377-51281399 TGGGTTCTCAGTAGGAATGCTGG - Exonic
1097345707 12:58489549-58489571 GAGGTTGTCAGAAACAAAGGGGG - Intergenic
1098431274 12:70422721-70422743 TGAGTTCTCAGAAATAAAGAGGG - Intronic
1098860089 12:75699584-75699606 TATAGTCCCAGAAAGAAAGCAGG + Intergenic
1099728359 12:86464039-86464061 AAAGCACTCAGAAAGAAAGCTGG - Intronic
1102545942 12:113655562-113655584 CAGATTCTCAGAAAGAAAGCTGG - Intergenic
1103695484 12:122812140-122812162 TAGGTTCTAAGAAATAAAGGGGG + Intronic
1103990629 12:124796998-124797020 TAGGCTCTGGGAAGGAAAGCAGG - Intronic
1104437551 12:128767850-128767872 TAGTTTCTTCCAAAGAAAGCTGG - Intergenic
1105348111 13:19592163-19592185 CTGGTTCTCAGAAAGCAAACTGG - Intergenic
1105658752 13:22470058-22470080 TAGTTTATCAGTAAGAAAACTGG + Intergenic
1105816643 13:24042169-24042191 TGGGTTGTGAGAGAGAAAGCAGG + Intronic
1107910610 13:45101946-45101968 TAGCTTATTAGAAAAAAAGCTGG + Intergenic
1108194815 13:47982630-47982652 TGCATTCTCAGAAAGAAAGAAGG - Intronic
1108568560 13:51726570-51726592 CAGATTCCCAGAAGGAAAGCAGG + Intronic
1109535937 13:63719554-63719576 TTGGTTCTCAGAAGGTAAGTAGG + Intergenic
1109540164 13:63766732-63766754 TTGGTTCTCAGAAGGTAAGTAGG - Intergenic
1112135688 13:96575377-96575399 TATGTTCTCAGAAACATAGATGG + Intronic
1112878359 13:104074341-104074363 TAGACTATCAGAAAGAAACCAGG - Intergenic
1112919781 13:104597880-104597902 TCAGTTCTCAGAAAGAAGGAGGG - Intergenic
1113156505 13:107328752-107328774 TAGGTTCACAGCAGGAAATCAGG + Intronic
1114471922 14:22969032-22969054 TGGGTTATCAAAAATAAAGCTGG - Intronic
1116487421 14:45467333-45467355 TAGATTCTCAGAATGAAGGCAGG - Intergenic
1118059050 14:62115943-62115965 TAGGTGCTGAGAGAGCAAGCAGG + Intergenic
1118169700 14:63376352-63376374 TAGTTTCTCAAAAAGGATGCTGG + Intronic
1119277742 14:73374461-73374483 AAGGTTCTCTGAAAGAAGGAAGG - Intronic
1119667489 14:76495515-76495537 TAGATGCTCAGAAAGCAGGCTGG + Intronic
1120038914 14:79730018-79730040 ATGCTTCTCAGAAAGAAAGGGGG + Intronic
1121301636 14:92876323-92876345 TAGGTTCACAGAATGAAACACGG - Intergenic
1123460250 15:20463845-20463867 TAGCTTCACAGAACTAAAGCGGG + Intergenic
1123504327 15:20924505-20924527 TAGGTTGTTATAAAGGAAGCTGG - Intergenic
1123561573 15:21498204-21498226 TAGGTTGTTATAAAGGAAGCTGG - Intergenic
1123597817 15:21935485-21935507 TAGGTTGTTATAAAGGAAGCTGG - Intergenic
1123657812 15:22536572-22536594 TAGCTTCACAGAACTAAAGCGGG - Intergenic
1124061131 15:26294539-26294561 CAGGTCCTGAGAAAGACAGCTGG + Intergenic
1124266471 15:28239574-28239596 TAGCTTCACAGAACTAAAGCGGG + Intronic
1124311721 15:28631770-28631792 TAGCTTCACAGAACTAAAGCGGG - Intergenic
1124872589 15:33558063-33558085 AATGTTCTCAGAAAAAAAACTGG - Intronic
1125217361 15:37290632-37290654 TGAGGTCTCAGAAAGAAAGCAGG - Intergenic
1125814052 15:42568628-42568650 TAGACTCCCAGGAAGAAAGCAGG - Exonic
1127027138 15:54819419-54819441 TAGGATTTGATAAAGAAAGCTGG - Intergenic
1128807063 15:70538972-70538994 CAGGCTCCCAGAAGGAAAGCAGG - Intergenic
1128862421 15:71085052-71085074 CAGGCTCTCAGAAGGAAGGCAGG - Intergenic
1129409558 15:75341727-75341749 TAGGGTCTCAGAAGGTAAGGAGG + Intronic
1130516477 15:84629781-84629803 TTGGTTCTGAGAAGGAAACCTGG - Intergenic
1202969918 15_KI270727v1_random:225329-225351 TAGGTTGTTATAAAGGAAGCTGG - Intergenic
1133445304 16:5854741-5854763 TAGGTACTCAGAAGGATTGCTGG + Intergenic
1133466565 16:6032944-6032966 TAGCTTCTCAGAAGCTAAGCTGG - Intronic
1134168928 16:11952873-11952895 TATGTTCTAACAAAGAAAGATGG - Intronic
1135517279 16:23146721-23146743 TAGTTCGTCAGCAAGAAAGCAGG + Intronic
1136597381 16:31260687-31260709 TAGGTGCTCAGAAGGGAGGCTGG + Intronic
1136622835 16:31441913-31441935 TAAGTTCTGAGAAAGCAAACGGG + Intronic
1136631565 16:31492067-31492089 CAGGTCCTAAGAAAGAGAGCTGG - Exonic
1136704665 16:32177020-32177042 TAGCTTCACAGAACTAAAGCGGG + Intergenic
1136763248 16:32752386-32752408 TAGCTTCACAGAACTAAAGCGGG - Intergenic
1136804852 16:33118000-33118022 TAGCTTCACAGAACTAAAGCGGG + Intergenic
1137695548 16:50459797-50459819 GAGGTGCTCAGAAAGAAATTGGG - Intergenic
1137809691 16:51340980-51341002 TAGGTGCTCAGAAAAAAAAGGGG - Intergenic
1137921442 16:52492921-52492943 ACTGTTCTCAGAACGAAAGCTGG - Intronic
1138670979 16:58614412-58614434 TAGGCTCCTAGACAGAAAGCTGG - Intronic
1139224141 16:65217829-65217851 TAGGTCCCCAGAAAGAAATAAGG + Intergenic
1140333137 16:74076862-74076884 TAGTAGCTCTGAAAGAAAGCTGG + Intergenic
1141292499 16:82732932-82732954 TAGGATCTCAGAAAGACAAATGG + Intronic
1203065399 16_KI270728v1_random:1012708-1012730 TAGCTTCACAGAACTAAAGCGGG - Intergenic
1146392358 17:32434366-32434388 TAGGTTCTCAGTTGGAAACCTGG + Intergenic
1147123341 17:38349371-38349393 GAGTTTCTCAGAGAGAAAGCTGG + Intergenic
1148212903 17:45818956-45818978 GAGGTGATCCGAAAGAAAGCAGG - Intronic
1149093443 17:52813175-52813197 TATATTCTCAGAAATAAAGGAGG + Intergenic
1149547118 17:57511791-57511813 TGGCTTTTCAGAAAGAAACCTGG - Intronic
1149856745 17:60089180-60089202 TGGGTTCTCAGAAATGAAGTTGG - Intergenic
1150059019 17:62047906-62047928 GAGTTTTTCATAAAGAAAGCCGG + Intronic
1150904310 17:69321255-69321277 GAGGTTTCCAGAAAGAAAGGTGG + Intronic
1150989938 17:70245501-70245523 TAGGGTCTGACCAAGAAAGCTGG - Intergenic
1151172967 17:72263583-72263605 CAGGGTCTCACAAAGGAAGCAGG + Intergenic
1151607072 17:75144572-75144594 GAGGTTCACAGAAAGAACTCAGG - Intronic
1153404276 18:4718536-4718558 TGGGTTCTCAGAGAAAAAACTGG + Intergenic
1153629774 18:7058152-7058174 TAAGCTCTCAGAATAAAAGCTGG - Intronic
1153829531 18:8909711-8909733 TTGGTTCACAGAAACAAAGTGGG - Intergenic
1155316258 18:24574196-24574218 TATGATATGAGAAAGAAAGCAGG - Intergenic
1159024376 18:63169063-63169085 TAGATTCTCAGAATCAAGGCTGG - Intronic
1159726149 18:71962222-71962244 TAGGGTTTCAGAAAGAAACCAGG - Intergenic
1161126735 19:2562080-2562102 CTGCTTCTCAGAAAGAAACCAGG + Intronic
1162016038 19:7846968-7846990 TAGGGTCAGAGGAAGAAAGCAGG - Intronic
1163951372 19:20590830-20590852 TCTGTTCTCTGAAAGAAAGGTGG - Intronic
1163965251 19:20740262-20740284 TCTGTTCTCTGAAAGAAAGGTGG + Intronic
1166264954 19:41674653-41674675 TAGGTCTTCAGGAAGAGAGCAGG + Exonic
1166713442 19:44951568-44951590 GGGGTTCTGAGAAAGAAAGGAGG - Intronic
1167424679 19:49423911-49423933 AAGGCTCTCAGAAAGACAGACGG + Exonic
925019161 2:554798-554820 CAGGTCCTCATAAACAAAGCAGG - Intergenic
925665846 2:6255046-6255068 GAAGTTCTCAGATAGAAAGATGG - Intergenic
925948184 2:8886065-8886087 CAGGCTCCCAGAAGGAAAGCAGG - Intronic
926612835 2:14963553-14963575 CAGGTTCCCAGAAGGAAAGTAGG - Intergenic
927521163 2:23699237-23699259 GAGGCTCACAGAAAGAAAGCAGG + Intronic
927577541 2:24212112-24212134 TTGCTTATCAAAAAGAAAGCTGG + Intronic
928626814 2:33148330-33148352 TATGTTATCAGAAAGAATGATGG - Intronic
929765782 2:44843087-44843109 TAGGTTTTCAGAGTGAAAGTAGG - Intergenic
929770174 2:44885133-44885155 GAGGTTCACAGAGAGAAAGTGGG - Intergenic
929838903 2:45435305-45435327 AGTGTTCTCAGACAGAAAGCTGG - Intronic
931676462 2:64701471-64701493 TAGCATCCCAGAAAGAAAGAAGG - Intronic
932961396 2:76416085-76416107 TAGACTCTCAGAAAGAGAGTGGG - Intergenic
933241545 2:79926920-79926942 TAGGTTTTCAGAGAGAGAGCTGG + Intronic
935090711 2:99892555-99892577 TGGGGCCTCTGAAAGAAAGCAGG + Intronic
935180117 2:100681660-100681682 TAGTTTCTAATAAAGAAAGATGG - Intergenic
937270781 2:120650470-120650492 TGGGTTCTTAGAAAGAAAGAAGG - Intergenic
937393467 2:121513901-121513923 CAGACTCTCAGAAGGAAAGCAGG + Intronic
937620989 2:123985075-123985097 TAGATTATCAGAATGAAAGAAGG + Intergenic
937665556 2:124483193-124483215 CAGGTTCTCAGAGGTAAAGCAGG + Intronic
938584521 2:132676356-132676378 TAGGCCTTCAAAAAGAAAGCTGG - Intronic
938835086 2:135094072-135094094 CAGGCTCCCAGAAGGAAAGCAGG + Intronic
939108511 2:137978008-137978030 CAGGTGCTCAGAAAGGATGCAGG - Intronic
939374946 2:141352510-141352532 TTGGTTCTCAGAAAAGATGCTGG + Intronic
940421296 2:153482132-153482154 TAGGTTCTGAGAAAGAATTTGGG - Intergenic
941527051 2:166618871-166618893 TAGGTTCTCAGAAAGATTGGAGG - Intergenic
943595799 2:189853993-189854015 TCGATTTTCAGAAAGAAAACAGG - Exonic
944327917 2:198428739-198428761 TAAATGCTCACAAAGAAAGCAGG - Intronic
944739875 2:202601510-202601532 TTGGTTCCCAAAAAGAAAGGAGG + Intergenic
944739963 2:202602304-202602326 TGGGTTCTCAAAAGGAAAGGAGG + Intergenic
945669120 2:212780979-212781001 TAGGTTTTTACAAAGAAAGGAGG - Intergenic
946611206 2:221459819-221459841 GAGGTCATTAGAAAGAAAGCAGG + Intronic
947134600 2:226964590-226964612 TAGAGGCTCAGAAAGAAAACTGG - Intronic
947481519 2:230504708-230504730 CAGATTCCCAGAAGGAAAGCGGG + Intronic
947778223 2:232732325-232732347 CAGGACCTCAGAAAGAAAGGGGG - Intronic
948354745 2:237368985-237369007 TAGGTTTTCAGATAGAATTCTGG + Exonic
948527950 2:238584706-238584728 CAGGTTCTCACAATGAAATCAGG - Intergenic
948937097 2:241173665-241173687 TGGGTTTTCAGAGAGAAACCGGG - Intronic
1169179797 20:3553669-3553691 TACGTTTTGAGTAAGAAAGCAGG - Intronic
1169475685 20:5929291-5929313 AGGGATCTCAGAAGGAAAGCTGG - Intergenic
1169697380 20:8405592-8405614 CAGCTTCTCAGAAGGAAAGTGGG - Intronic
1170960782 20:21023810-21023832 TAGTTTCTCCCAAAGAAAGGAGG - Intergenic
1171233233 20:23504305-23504327 TTGGTTCACAGAAAGAACTCTGG - Intergenic
1172095446 20:32457900-32457922 TAGGTGCTCAGTAAAAATGCTGG - Intronic
1178575168 21:33781290-33781312 TAATTTCTTGGAAAGAAAGCAGG + Intronic
1178635380 21:34297965-34297987 TAGTTTCACAGATAGGAAGCAGG + Intergenic
1178934376 21:36849215-36849237 CAGGTTCTCAGAAACATATCTGG + Intronic
1178973770 21:37204684-37204706 TATGACCTCAGAAAGAAAGAAGG + Intergenic
1179105922 21:38400330-38400352 TAGCTTTTCAGAAAGACAGATGG - Intronic
1181146990 22:20855775-20855797 CAGATTCCCAGAAGGAAAGCAGG + Intronic
1181892036 22:26071764-26071786 CAGACTCTCAGAAAGAAAGCAGG - Intergenic
1182859105 22:33543963-33543985 TAGACTCCCAGAAGGAAAGCAGG - Intronic
1185072764 22:48666376-48666398 TAGGTTTACAGAAAGAGAGCAGG + Intronic
1185075567 22:48680312-48680334 TGGGTTCTCAGAACAAAAGATGG + Intronic
951957013 3:28268521-28268543 CAGATTCCCAGAAGGAAAGCAGG + Intronic
952807355 3:37369003-37369025 TAGGGTGTGAGAAAGAAAGAAGG - Intergenic
953351945 3:42222504-42222526 TAGGTACTAAGAAGGAATGCTGG + Intronic
955647522 3:61155933-61155955 TAGACTCCCAGAAGGAAAGCAGG - Intronic
959300858 3:104599176-104599198 TTTGTTCTCTGAAAGAAATCTGG - Intergenic
959683523 3:109122625-109122647 GAGGTTCTCTGAGAGAAGGCTGG + Intergenic
960267505 3:115637363-115637385 TAATTTCTCAGAAAGACAGGTGG + Intronic
960628547 3:119704455-119704477 TAAGGTCAAAGAAAGAAAGCAGG - Intronic
962503707 3:136023839-136023861 TAGGTTTTAAGCAAGAAAGTAGG - Intronic
963504678 3:146169124-146169146 TAGGTATTCAAAGAGAAAGCAGG - Intergenic
964712613 3:159687178-159687200 TATTTTCTCAGACAGAAAGTAGG + Intronic
964946259 3:162228677-162228699 CTGCTTCTCAGAAAGAAAGCAGG - Intergenic
965276901 3:166695273-166695295 TTTGTTCTAAGAAAGAATGCAGG + Intergenic
965973926 3:174597346-174597368 TAGTCTCCCAGAAGGAAAGCAGG + Intronic
968827622 4:2911191-2911213 CAGGTTCTCAGATGGGAAGCAGG - Intronic
970465764 4:16321477-16321499 TAAGTTCAGAGAAATAAAGCTGG - Intergenic
970495970 4:16626544-16626566 CAGGTTCTCACAGAGAAATCAGG + Intronic
971072801 4:23113803-23113825 TGATTTGTCAGAAAGAAAGCAGG - Intergenic
971238526 4:24866039-24866061 TAGGTTCTGAGCAACAAACCAGG + Intronic
972692876 4:41416866-41416888 TAGTTTCTCAGAAAGAAATAGGG + Intronic
973676458 4:53268427-53268449 TGGGTTGTCAGAACCAAAGCAGG + Intronic
975372944 4:73609141-73609163 TAGGTTCTGAGAGTGAAATCTGG + Intronic
975627343 4:76363129-76363151 CACGTTCCCAGAAGGAAAGCAGG - Intronic
976168181 4:82276703-82276725 TGGGTTCTCAGTAAGAATGATGG + Intergenic
978498033 4:109380695-109380717 TAGGTAATGAGAAAAAAAGCAGG + Intergenic
979605117 4:122630367-122630389 TAGGGATTCAGAAAGTAAGCAGG - Intergenic
979809453 4:125017391-125017413 TGGGTGCTCAGAAAGAGAGGGGG - Intergenic
980481447 4:133393373-133393395 TATATTCACAGAATGAAAGCTGG + Intergenic
981707662 4:147678653-147678675 TAGATTCCCAGAAGAAAAGCAGG - Intronic
983114141 4:163791727-163791749 TAGGTAATTAGAAAGAAATCAGG - Intronic
983283790 4:165714093-165714115 TATGAACTCAGAAAGAAAGTGGG + Intergenic
985787589 5:1906563-1906585 TAGATTCTCATTAAGAAAACTGG - Intergenic
986274588 5:6262599-6262621 CAGATTCTCAGAAAGAAAGCAGG - Intergenic
987258879 5:16183486-16183508 TAGGTTCTCAGAGAAAAGCCAGG - Intergenic
988661108 5:33269662-33269684 TATAGTCTCAGAAAGAAAACTGG + Intergenic
989062758 5:37425852-37425874 TAGTTGCTGAGATAGAAAGCAGG + Intronic
989336598 5:40324482-40324504 CAGGTCCTCAGAGAGAAAACCGG + Intergenic
990385233 5:55253920-55253942 CAGGCTCCCAGAAGGAAAGCAGG - Intergenic
990493117 5:56321252-56321274 TAGTTCTTCAGAAGGAAAGCAGG + Intergenic
991449333 5:66735070-66735092 TATGCTGTCAGAAAGAAAACAGG - Intronic
991501214 5:67279311-67279333 TAGGTTCTCAGATACTATGCAGG + Intergenic
991982912 5:72251859-72251881 GGGGTTCTTAGAAACAAAGCTGG - Intronic
992349231 5:75911971-75911993 TGGGTTCTCAGTAGGAATGCTGG + Intergenic
992502336 5:77355182-77355204 TAGAGCCTCAGAAAAAAAGCAGG - Intronic
994049887 5:95350391-95350413 AGGCTTGTCAGAAAGAAAGCAGG + Intergenic
995087082 5:108123957-108123979 TATATTCTCAAAAAGAATGCTGG - Intronic
995917293 5:117263173-117263195 GAGGTACTCAGAAAGGAATCTGG - Intergenic
997756903 5:136408035-136408057 TAGTTTCTTAAAAAGAAATCAGG - Intergenic
997834019 5:137177869-137177891 TAGGGACTGAGAAATAAAGCTGG + Intronic
1001590936 5:172864747-172864769 TAGGTGCTCAAAAAAAAAGGGGG - Intronic
1004031808 6:11877582-11877604 TATGTTCTCAGAAAAAGAACTGG + Intergenic
1007119293 6:39366984-39367006 AAGGGTCTGGGAAAGAAAGCTGG + Intronic
1008114356 6:47530362-47530384 TAGGATCACAGAAAGAGAGATGG - Intronic
1010264997 6:73856165-73856187 TGGGTCTTCAGAAAGAAAACTGG + Intergenic
1010522854 6:76862125-76862147 AAGATTCTCAGGAAGAAAGGAGG - Intergenic
1011928844 6:92684148-92684170 TAGCTCCTCAGAAAGAAAATGGG - Intergenic
1013563032 6:111325573-111325595 TGTGTTCTCTGAAGGAAAGCAGG + Intronic
1014240485 6:119012668-119012690 CAGATTCCCAGAAGGAAAGCAGG + Intronic
1016895074 6:149043444-149043466 TTGCTTCCCAGAAAAAAAGCAGG - Intronic
1017478205 6:154821513-154821535 TAAGTTCTAAGAAAAAAATCAGG + Intronic
1018006642 6:159628444-159628466 AAGGTTCACAGAGAGAAAGGGGG - Intergenic
1018182501 6:161236521-161236543 CAGGTTCACACAAAGAAATCTGG + Intronic
1019771132 7:2884175-2884197 TGGGTCCTCAGAAAGGAGGCTGG + Intergenic
1020064876 7:5180412-5180434 TAGATTCTCAGAAACACAGCAGG + Intergenic
1020588637 7:10105587-10105609 TAGGTTGTCACAGAGAAAGTGGG - Intergenic
1020835060 7:13138892-13138914 TAGCTACTCAGAGAAAAAGCAGG + Intergenic
1021789829 7:24193787-24193809 TAGATGCTCAGGATGAAAGCCGG + Intergenic
1021921626 7:25491005-25491027 CAGCTTCTCAGGAAGAAAGCAGG + Intergenic
1022277401 7:28868954-28868976 TATGTTCTCAGAAATGAATCAGG - Intergenic
1023495773 7:40795194-40795216 GAGGTGCACTGAAAGAAAGCTGG + Intronic
1024365269 7:48513155-48513177 TAGGTCCTTAGAAGGACAGCAGG - Intronic
1027784197 7:82558358-82558380 TCTGTTTTCAGAAAGAAAACCGG - Intergenic
1030180432 7:106702386-106702408 AAGGTTATCAGAAACAAAGAGGG - Intergenic
1033431582 7:141294405-141294427 GAGGCTGTCAGAGAGAAAGCTGG - Intronic
1033599914 7:142881887-142881909 TAGGTGCTGAGAAACAAGGCAGG + Intronic
1034851733 7:154500122-154500144 TAGACTTTCAGAAGGAAAGCAGG + Intronic
1036283586 8:7422790-7422812 TAGGTGCTCAGATAGCAAACTGG + Intergenic
1036337883 8:7888731-7888753 TAGGTGCTCAGATAGCAAACTGG - Intergenic
1036404479 8:8442439-8442461 CAGGTTTTCAGCAAGAGAGCGGG + Intergenic
1037488824 8:19376841-19376863 TAAGTTCTCAGAATGTAATCAGG + Intronic
1037507291 8:19543496-19543518 CAGGCTCTCAGAAAGAAAGTAGG - Intronic
1037824355 8:22152073-22152095 CAGGTTTTCAGAAATAGAGCTGG + Intronic
1041999117 8:64101390-64101412 GAGCATCTCAGAACGAAAGCAGG + Intergenic
1042666571 8:71213307-71213329 TAGGTTCTCAGAAAGAAAGCAGG - Intronic
1042913411 8:73849845-73849867 TAAGTTTTAAGAAACAAAGCTGG + Intronic
1043468887 8:80542298-80542320 TATATTCACAGAAAGAAACCTGG + Intergenic
1044501392 8:92962870-92962892 TAGGTTCTGGGAAAGAGAGTAGG + Intronic
1045318371 8:101062881-101062903 GACTTTCTCAGAAAAAAAGCAGG - Intergenic
1046262516 8:111787684-111787706 TAGGTTTTCACAAAGAAAAGTGG + Intergenic
1046793617 8:118347280-118347302 TAGGCTCCCAGAAGGAAAGCAGG + Intronic
1046913226 8:119651790-119651812 TAAGATCTCAGAGAGAATGCTGG + Intronic
1047713760 8:127576851-127576873 TAGGTTCACAGAGAGAAGGCTGG - Intergenic
1047938832 8:129807929-129807951 TAGGTGCTCAGACAGAAGCCTGG + Intergenic
1048109784 8:131455000-131455022 TAGGTTCTCCCAAATAAATCAGG + Intergenic
1048946716 8:139455536-139455558 CAGATTCCCAGAAGGAAAGCAGG + Intergenic
1049103245 8:140594457-140594479 TTGGTTCTAAGAAAGAGGGCCGG - Intronic
1050170542 9:2811271-2811293 TGGGGTGTCAGTAAGAAAGCTGG - Intronic
1055020102 9:71660355-71660377 CAGGTTCTCACAATGAAGGCTGG + Intergenic
1056277218 9:85005095-85005117 CAGGTTCTAGGAAACAAAGCAGG - Intronic
1056415950 9:86376443-86376465 TAGGGTCTCTGAAACAAAGCTGG + Intergenic
1057380454 9:94562709-94562731 GAGGTTCTCTGCAAGATAGCTGG + Intronic
1057786535 9:98092324-98092346 TGAGTGCTCAGAAAGAAAGAAGG + Intronic
1058803820 9:108570272-108570294 AAGGTTCACAGAAAGCTAGCCGG + Intergenic
1059460111 9:114424248-114424270 TAGGTTCTCAGCAAAGGAGCGGG + Intronic
1059633351 9:116148828-116148850 GAGCTGCACAGAAAGAAAGCTGG - Intergenic
1059984265 9:119806693-119806715 TAGGGACTCAGAAACAAAGCAGG - Intergenic
1060040632 9:120297275-120297297 TGTGTTCTCAGAACGCAAGCAGG - Intergenic
1061279031 9:129586569-129586591 TAGGTGCTCAGGAAGGAAGGAGG + Intergenic
1061577348 9:131515321-131515343 TTGCTTTTCAGAAACAAAGCCGG - Intronic
1185525410 X:774700-774722 TACGCTCTCGGAAAAAAAGCAGG - Intergenic
1186281449 X:7997530-7997552 TGGGTGCTCAGAATGAAGGCTGG - Intergenic
1186281458 X:7997588-7997610 TGGGTGCTCAGAATGAAGGCTGG - Intergenic
1187525242 X:20048216-20048238 CAGGTTCCCAGAAGGAAAGCAGG - Intronic
1187955347 X:24512201-24512223 TAGCTTCTTACAAAGAAAGGAGG - Intronic
1188088422 X:25931712-25931734 CAGGTTAGCAGAAAGAAAGTAGG - Intergenic
1188597557 X:31919862-31919884 TAGATTATCTGAAAGTAAGCTGG - Intronic
1188760100 X:34017250-34017272 AAGGTTTTCAGAAAGAAAACTGG + Intergenic
1189048114 X:37614930-37614952 TAAGTGCTCAGTAAGACAGCTGG - Intronic
1189521984 X:41779185-41779207 CAGACTCCCAGAAAGAAAGCAGG - Intronic
1190098831 X:47504627-47504649 CAGGCTCCCAGAATGAAAGCCGG - Intergenic
1192151744 X:68717083-68717105 CATGTTCTCAGCCAGAAAGCAGG + Intronic
1194332107 X:92596115-92596137 TAGGTTGTTAGAAAGACAGATGG - Intronic
1197968715 X:132093090-132093112 TAGGATCTCAGAAAGGCAGAGGG - Intronic
1199398460 X:147368098-147368120 TAGGTGCTGAGAAATAAGGCAGG + Intergenic
1200281747 X:154782862-154782884 TATGTTCCCAGAAAGAAATACGG - Intronic
1201308061 Y:12568173-12568195 TTGGTTGTCAGAAAGAAGCCTGG + Intergenic