ID: 1042666574

View in Genome Browser
Species Human (GRCh38)
Location 8:71213333-71213355
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042666571_1042666574 3 Left 1042666571 8:71213307-71213329 CCTGCTTTCTTTCTGAGAACCTA 0: 1
1: 0
2: 3
3: 31
4: 286
Right 1042666574 8:71213333-71213355 TCTACCCGCTTCTGTACTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr