ID: 1042666846

View in Genome Browser
Species Human (GRCh38)
Location 8:71216342-71216364
Sequence GGTTGTAAATCTCCTCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042666846_1042666853 17 Left 1042666846 8:71216342-71216364 CCTGTAGGAGGAGATTTACAACC 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1042666853 8:71216382-71216404 AGAGGTGGCTAATTCTTCGAAGG No data
1042666846_1042666851 -1 Left 1042666846 8:71216342-71216364 CCTGTAGGAGGAGATTTACAACC 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1042666851 8:71216364-71216386 CCATCTTGTGATTTGGGCAGAGG No data
1042666846_1042666847 -8 Left 1042666846 8:71216342-71216364 CCTGTAGGAGGAGATTTACAACC 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1042666847 8:71216357-71216379 TTACAACCCATCTTGTGATTTGG No data
1042666846_1042666848 -7 Left 1042666846 8:71216342-71216364 CCTGTAGGAGGAGATTTACAACC 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1042666848 8:71216358-71216380 TACAACCCATCTTGTGATTTGGG No data
1042666846_1042666852 2 Left 1042666846 8:71216342-71216364 CCTGTAGGAGGAGATTTACAACC 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1042666852 8:71216367-71216389 TCTTGTGATTTGGGCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042666846 Original CRISPR GGTTGTAAATCTCCTCCTAC AGG (reversed) Intronic
907189400 1:52635623-52635645 GGTTTTACAACTCCTCCTATAGG + Intronic
909490520 1:76221101-76221123 GGTTCTAAGACTGCTCCTACTGG + Intronic
909500638 1:76331186-76331208 GGTTGTTCATCTCCCCCTAGTGG - Intronic
913400683 1:118429463-118429485 TGTTTTAAATCTCTTCCTACAGG - Intergenic
1063979082 10:11439507-11439529 GCTTCTAAAACTCCTCCTTCTGG - Intergenic
1064330594 10:14390563-14390585 GGTTGAAAGTTTCCTCCTCCAGG + Intronic
1069982231 10:72260728-72260750 GGCTGTAACTCTTCTCCAACCGG - Intergenic
1070202200 10:74217621-74217643 AGTTGTCAGTCTGCTCCTACTGG - Intronic
1070750607 10:78961949-78961971 GTTTGTAAACCTCCTCCAGCAGG + Intergenic
1074848946 10:117423208-117423230 AGTTGTAAAACTCTTCCTGCGGG - Intergenic
1082743584 11:56938241-56938263 GGTTGTACATCGCATCCTAATGG + Intergenic
1083241970 11:61395275-61395297 GGTTATAAAACTTGTCCTACAGG - Intronic
1093179214 12:15949091-15949113 GGGTGTCAGTCTGCTCCTACTGG + Intronic
1096570075 12:52517628-52517650 GGTTGGCAATCTCCTCATACTGG + Exonic
1104929097 12:132328975-132328997 GGTTGTAGACCACCTCCTCCAGG + Intronic
1106827828 13:33543011-33543033 GTTTGTAAAGCTCCTCCTACAGG - Intergenic
1108283479 13:48882565-48882587 GATTGTAATTCTGCTCCTACTGG - Intergenic
1109176766 13:59166980-59167002 GGTTGAAACTGTCCTCCTATAGG + Intergenic
1122595638 14:102888467-102888489 TGTTGTAAATATCCACCTAGAGG + Intronic
1124896395 15:33781139-33781161 GGTTGTAAATCTGCTTCTGGAGG + Intronic
1132090901 15:98947385-98947407 GGTTGGAAATCTCCTGCCCCAGG + Intronic
1144100164 17:11935857-11935879 TGTTTTAAATCTCCTCTTATAGG - Intronic
1144435118 17:15233200-15233222 GGTGATACATCTCCACCTACTGG - Intronic
1146978494 17:37137225-37137247 GTTTGTCAGTCGCCTCCTACTGG + Intronic
1148057075 17:44805772-44805794 GGTTGTGAATCTCCTCTAGCAGG + Exonic
1149343089 17:55707001-55707023 GGTTTTAAATCCTTTCCTACCGG - Intergenic
1149546435 17:57507185-57507207 GGGTGTAAATCTCTTCCCATTGG + Intronic
1157711609 18:49853547-49853569 GTTTGTCCATCTCCTCCTTCAGG + Exonic
1168000233 19:53439888-53439910 GGTTTTAATTCTGCTACTACTGG + Intronic
926529357 2:14023395-14023417 GGAAGCAAATCTCCTCCTATGGG - Intergenic
928299989 2:30116494-30116516 GGTTGTGCATCTGCTCTTACAGG + Intergenic
933073443 2:77891653-77891675 TGTTCTAAATTTCCTCCTCCAGG - Intergenic
934216687 2:90037772-90037794 GGGTGTTAATTTCCTTCTACTGG + Intergenic
939858105 2:147385169-147385191 GGGTATCCATCTCCTCCTACTGG + Intergenic
942062291 2:172239012-172239034 GGTATTAACTCTCCTTCTACAGG - Intergenic
1172358686 20:34297242-34297264 GGTTGTGATTGTCCTCCTGCTGG - Intronic
1181263913 22:21619031-21619053 GGTAGTAATTCTCCTGTTACAGG + Intronic
952936974 3:38406136-38406158 GGCTGTCAATCTGCCCCTACTGG - Intronic
957780752 3:84815161-84815183 GGGTGTCAGTCTGCTCCTACTGG + Intergenic
959366490 3:105465680-105465702 TGTTTTACTTCTCCTCCTACTGG + Intronic
961075911 3:123981550-123981572 GGCTGAAAATATCCGCCTACAGG + Intronic
962278856 3:134035488-134035510 GCTTGACAATCTCCTCCTCCAGG - Intronic
963413184 3:144958648-144958670 AGTAGGAAATCTCCTCCTGCTGG - Intergenic
966071953 3:175888900-175888922 GGTTATCAATTTCCTCCTACTGG - Intergenic
968107299 3:196010337-196010359 GCTTGTAACTCTCCTGCCACTGG + Intergenic
972793351 4:42393612-42393634 TGTTGTAAATCTCTTACTCCAGG - Intergenic
974119737 4:57624532-57624554 AGGTGTCAGTCTCCTCCTACTGG + Intergenic
975256618 4:72243947-72243969 GGTTATAAAACTCCTTCTAGAGG - Intergenic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
975931012 4:79522650-79522672 GGTTCTAAATCTCCTAAAACAGG - Intergenic
975957010 4:79853181-79853203 TGTTTTAAGTCTTCTCCTACAGG - Intergenic
976670536 4:87647780-87647802 GGTTGTTATTCTGCTCCTATGGG + Intergenic
976941287 4:90705365-90705387 AGTTGTCAGTCTCCCCCTACTGG + Intronic
979965900 4:127076752-127076774 GGTTGAAAAACACCTCATACAGG - Intergenic
988269152 5:28991771-28991793 GGGTGTCAATCTGCCCCTACTGG - Intergenic
989947955 5:50262367-50262389 AGTTGTCAGTCTGCTCCTACTGG + Intergenic
992190843 5:74290279-74290301 ATTTTTAAATCTCCTCTTACGGG - Intergenic
996877197 5:128252626-128252648 GGCTCTAAATCCACTCCTACAGG + Intergenic
999578008 5:153002134-153002156 GGATGTAAATATACTCCTAATGG + Intergenic
1000609909 5:163362669-163362691 GATTGTAAATGTCCTTCTATAGG - Intergenic
1003809002 6:9758865-9758887 GGTGGTAACTCTCTCCCTACTGG - Intronic
1003939541 6:11010443-11010465 GGTTGTAACTTTCCTTCTAAAGG - Intronic
1004422652 6:15485915-15485937 AGTTGTAAATCTCTTCCTATTGG - Intronic
1012561409 6:100585972-100585994 AGTTGTCAGTCTGCTCCTACTGG + Intronic
1013293081 6:108735480-108735502 GGCTGTAAAACTCCTGATACTGG - Intergenic
1015228444 6:130885541-130885563 GGTCTTAGAGCTCCTCCTACTGG - Intronic
1015759409 6:136642343-136642365 TGTTGCAAATCTCTTCCTAAAGG + Intronic
1017714678 6:157200788-157200810 GGTTGTACATCTCCTGCTGCTGG - Exonic
1019301893 7:309479-309501 GGGTGTAAGTCTCCTCCGAAGGG - Intergenic
1030133657 7:106224844-106224866 GGTTGTAAATCTCAGGCTGCTGG - Intergenic
1032630094 7:133641210-133641232 GATTGTAAATCACATCCTTCTGG + Intronic
1033364176 7:140658895-140658917 GGTTTTAATTCTACTACTACTGG - Intronic
1035844939 8:2852991-2853013 GGGAGTAAATCTCCACCTCCTGG - Intergenic
1038680563 8:29663431-29663453 GGGTGTAAATCACTTCCTCCAGG + Intergenic
1038933737 8:32224481-32224503 GGGTTTAAATATCCTCCCACTGG - Intronic
1040640397 8:49327500-49327522 GGTTGTCAACCTCCTCTTATTGG - Intergenic
1040962377 8:53048537-53048559 AGTTGTCAGTCTGCTCCTACTGG + Intergenic
1042666846 8:71216342-71216364 GGTTGTAAATCTCCTCCTACAGG - Intronic
1044199249 8:89414241-89414263 GGTTGGCAATCTCCTCATACTGG + Intergenic
1047415835 8:124663740-124663762 TTTTGTAAATGGCCTCCTACAGG + Intronic
1049104107 8:140600719-140600741 GGATGTAATTCTCCTCCGAATGG - Intronic
1049507176 8:143008974-143008996 TGTGGTTAATCTCCTCCTGCCGG + Intergenic
1052853321 9:33391416-33391438 GGTTGTAGATCACATGCTACGGG - Intronic
1053103767 9:35393282-35393304 GCTTGTACATCACCTCCTCCAGG - Intronic
1053559976 9:39181999-39182021 GGTTGTAAATCTCTTTTTCCTGG - Intronic
1053681353 9:40487588-40487610 GGTTGTAGATCACATGCTACGGG - Intergenic
1053824082 9:42002220-42002242 GGTTGTAAATCTCTTTTTCCTGG - Intronic
1053931343 9:43115918-43115940 GGTTGTAGATCACATACTACGGG - Intergenic
1054137140 9:61436956-61436978 GGTTGTAAATCTCTTTTTCCTGG + Intergenic
1054282360 9:63137346-63137368 GGTTGTAGATCACATGCTACGGG + Intergenic
1054294442 9:63323104-63323126 GGTTGTAGATCACATGCTACGGG - Intergenic
1054392463 9:64627592-64627614 GGTTGTAGATCACATGCTACGGG - Intergenic
1054427111 9:65132801-65132823 GGTTGTAGATCACATGCTACGGG - Intergenic
1054503264 9:65888738-65888760 GGTTGTAGATCACATGCTACGGG + Intronic
1054606492 9:67185144-67185166 GGTTGTAAATCTCTTTTTCCTGG + Intergenic
1054938243 9:70712266-70712288 GCTTGTACATCACCTCCTCCAGG - Intronic
1054939934 9:70730259-70730281 GCTTGTACATCACCTCCTCCAGG - Intronic
1058533051 9:105925947-105925969 GGTTGAATATCTCCTCCTTCTGG - Intergenic
1059931601 9:119266165-119266187 GGTTGTATTTCTCCTCCTTGAGG - Intronic
1186756342 X:12675547-12675569 GGATGGAAATGTCCTCCAACTGG - Intronic
1190460434 X:50668069-50668091 TGTCGCAAATCTCCTCCTCCAGG + Intronic
1191122433 X:56920557-56920579 GGGTGTAAGTCATCTCCTACTGG + Intergenic
1191680978 X:63839381-63839403 AGTTGTCAATCTGCCCCTACTGG - Intergenic
1191758696 X:64623918-64623940 GGTTGACAATCTTCTCATACTGG - Intergenic
1193945790 X:87732316-87732338 GGTTGTTACTCTCCCTCTACTGG + Intergenic
1197744072 X:129919186-129919208 GGTTGAAAATTTCCTGCTCCAGG - Exonic
1200921733 Y:8619294-8619316 GGTTGTAGTACTCCACCTACAGG + Intergenic
1202188819 Y:22219591-22219613 AGTTGGAAATCTCCTCGTTCTGG - Intergenic