ID: 1042674931

View in Genome Browser
Species Human (GRCh38)
Location 8:71309752-71309774
Sequence TCCCTGCCTCATTATGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042674931_1042674934 -6 Left 1042674931 8:71309752-71309774 CCCACTTCATAATGAGGCAGGGA 0: 1
1: 0
2: 2
3: 15
4: 193
Right 1042674934 8:71309769-71309791 CAGGGATGCATGAGGTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042674931 Original CRISPR TCCCTGCCTCATTATGAAGT GGG (reversed) Intronic
902251791 1:15158389-15158411 TCCCTCCCTCTGTATGAATTTGG - Intronic
902360141 1:15937911-15937933 TCCCTGCCCCTTTCTGAAGGAGG + Exonic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
905731513 1:40302180-40302202 TCACTGCCACATGATGAGGTTGG + Intronic
905904437 1:41608467-41608489 TGCCTGCCTCTTTGTGAAGAAGG + Intronic
907592787 1:55691561-55691583 TCACTGCCTCATTATGAGTTTGG + Intergenic
908767209 1:67564927-67564949 TCTCTGCCTGATTCTGAAGTGGG - Intergenic
908962638 1:69717634-69717656 TCCCTCCCTCAATATGAAGTTGG - Intronic
911188087 1:94923726-94923748 TCCCTGCCTCTTTAAGTATTTGG - Intronic
914250974 1:145920998-145921020 TCCCTGCCCCAATCTGAAGGAGG - Intergenic
916340573 1:163729004-163729026 TCCATGCCTTATTTTGAAGATGG - Intergenic
917637705 1:176953232-176953254 TCCGTTCCAGATTATGAAGTGGG + Intronic
918189671 1:182162138-182162160 TCCCTGTCTCTTTTTGAACTTGG + Intergenic
919413026 1:197270516-197270538 TCCTAGCATCATTATGTAGTAGG - Intronic
920931775 1:210395350-210395372 TTCCTGACTCCTTATGAAGAAGG + Intronic
921309480 1:213828525-213828547 TCCATGTCTCATTCTGAACTTGG - Intergenic
922580095 1:226690726-226690748 TCCCTGCCTGCTTGTGAGGTAGG - Intronic
1063063990 10:2590480-2590502 TGCCTGCCTCCTTAGGAATTGGG - Intergenic
1063064001 10:2590547-2590569 TGCCTGCCTCATTAGGAATTGGG - Intergenic
1063814256 10:9755107-9755129 TCCCTGCTTCAGGGTGAAGTGGG + Intergenic
1068264716 10:54631791-54631813 TTCCTGCCTCCTTATGAAAAAGG - Intronic
1069409345 10:68136532-68136554 TCCCTGCCTAATTTCTAAGTGGG + Intronic
1070107796 10:73452223-73452245 TACCTACAACATTATGAAGTAGG + Intronic
1074182858 10:111078662-111078684 TCCCTGCCTCATCATGATCCTGG + Exonic
1074575967 10:114669728-114669750 AGCCTGCCTCAGGATGAAGTGGG + Intronic
1074726595 10:116316363-116316385 TCCCTGCCACTATATGAAGAAGG + Intergenic
1075672257 10:124270622-124270644 TCCCTGCCTCATGGTGCAGCAGG - Intergenic
1075889069 10:125929980-125930002 TTCCTGCCTCAGTATCAAGTAGG + Intronic
1076570132 10:131426986-131427008 ACTCTTCCTCATTATGAAGCTGG + Intergenic
1079802578 11:24888874-24888896 TTCCTGCCTCCTTGTGAAGAAGG + Intronic
1083006860 11:59355238-59355260 TCCCTGCCTCCCTAGGGAGTAGG - Intergenic
1085146408 11:74202123-74202145 TTCCTGACACATTATGAACTTGG - Intronic
1086795723 11:91099511-91099533 TTCCTGCGTCATTAAGATGTAGG - Intergenic
1087582690 11:100079000-100079022 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1089296877 11:117474701-117474723 TCCCTTTCTCCTTATCAAGTGGG + Intronic
1091292101 11:134446566-134446588 ACCCTGACTCATTATCCAGTAGG - Intergenic
1092139500 12:6173108-6173130 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1093603481 12:21060318-21060340 TCCCTCCCTCAGTATGTTGTTGG + Intronic
1094451251 12:30585180-30585202 TCACAGCTTCATTATTAAGTAGG - Intergenic
1096155414 12:49338986-49339008 TCCCAGCATCATTATGAGGCGGG - Intergenic
1098646692 12:72910921-72910943 TGACTGCCTCATTCTGAAGTGGG - Intergenic
1098771723 12:74560761-74560783 TCCCTGCCACATTATGAAGAAGG - Intergenic
1102815616 12:115863298-115863320 TGCCTGCGTCTTTATGAAGGTGG - Intergenic
1105465164 13:20633304-20633326 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1105545560 13:21348214-21348236 TCCCCCCCTCAGTGTGAAGTGGG - Intergenic
1106788516 13:33130578-33130600 TCCCTGACTGATTATAAAGAGGG + Intronic
1108666502 13:52637427-52637449 TACCTGCTTCATTATTAATTGGG - Intergenic
1109189663 13:59309163-59309185 TCCCTGCCACCATATGAAGAAGG - Intergenic
1110724366 13:78802693-78802715 TTCCTGCCGCCTTATGAAGAAGG - Intergenic
1111341387 13:86890898-86890920 TCCCTACCAGATTGTGAAGTTGG + Intergenic
1111935833 13:94556352-94556374 TCTCTGCCTTTTGATGAAGTGGG + Intergenic
1112918183 13:104576909-104576931 TACCTGCTTCAGTATGAAGCAGG + Intergenic
1114421967 14:22591288-22591310 TCTCTGCCTCATCAACAAGTAGG + Intergenic
1115571600 14:34671871-34671893 CTCCTGCCACATTATGAAGAAGG - Intergenic
1115699346 14:35935246-35935268 TCCTTGTCTCCTTGTGAAGTGGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118477735 14:66133877-66133899 TTCCTGGCTCATTATAATGTTGG + Intergenic
1118715574 14:68557359-68557381 TCCCTACTTTATTATAAAGTAGG - Intronic
1119839225 14:77778614-77778636 TTCCTGCCACCTTATGAAGAAGG + Intergenic
1120121206 14:80681666-80681688 TCCCTGCCGCCTTATGAAGAAGG + Intronic
1121715828 14:96073347-96073369 TTCCAGCCTCATTAAAAAGTGGG + Intronic
1122162678 14:99796769-99796791 TCGAGGCCTCATTTTGAAGTAGG + Intronic
1124191625 15:27582577-27582599 TCACTGCCTTCTTTTGAAGTGGG - Intergenic
1124816505 15:32999522-32999544 TCCCTGGATCATTTTGCAGTGGG + Intronic
1130347064 15:83057370-83057392 TCACAACCACATTATGAAGTAGG - Intronic
1131128323 15:89875536-89875558 TTCTTGCCTCATCATGAAATAGG - Intronic
1135335111 16:21595031-21595053 TCACTGCATCCTTATGAAATAGG + Intergenic
1138499102 16:57427623-57427645 TCCCTGCCACCTTGTGAAGGAGG + Intergenic
1138938727 16:61763019-61763041 TCCCTGCCCCAGCAGGAAGTTGG - Intronic
1139313186 16:66044291-66044313 TCACTCACTCATTAAGAAGTTGG - Intergenic
1140226320 16:73080286-73080308 TCTCTGGGTCATTCTGAAGTAGG - Intergenic
1141306259 16:82866760-82866782 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1142012017 16:87720294-87720316 TCCCTGCCTGATTGTGATTTCGG - Intronic
1143932116 17:10439972-10439994 TCCCTGCATCAGCATGACGTAGG + Intergenic
1147196077 17:38767743-38767765 TCCATTCTTCATTATGACGTGGG + Exonic
1148626878 17:49076183-49076205 TCCTTGCCTTATTATTAAGAGGG + Intergenic
1149406401 17:56356234-56356256 TCACAGCAACATTATGAAGTAGG + Intronic
1150137107 17:62702098-62702120 TCCCTGCCAAATTAGGAAGCGGG - Intronic
1153014313 18:569811-569833 TCTGTGCCACATTATGAAGGAGG + Intergenic
1155039324 18:22051787-22051809 TTTCTGGCTCACTATGAAGTAGG - Intergenic
1155434634 18:25799245-25799267 TCCCTGGCTACTTCTGAAGTAGG + Intergenic
1157644402 18:49252363-49252385 TCCCTGCCACTTTGTGAAGAAGG - Intronic
1164923225 19:32105272-32105294 GTTCTGCCTCATTTTGAAGTCGG + Intergenic
1166249382 19:41557057-41557079 TCCTTGGCTTTTTATGAAGTAGG - Intronic
925087583 2:1121644-1121666 TTCCTGCCACCTTATGAAGAAGG - Intronic
926400343 2:12490152-12490174 GCCCTGCCTCATTGTGCAGTGGG - Intergenic
929688626 2:44056274-44056296 ACCCTGCCTAATAATGAGGTAGG - Intergenic
930607628 2:53508963-53508985 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
939703139 2:145419553-145419575 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
941312478 2:163951446-163951468 TCCCTGCCTCTTTATAATTTTGG + Intergenic
941587486 2:167379153-167379175 TTCCTGCCCCCTTATGAAGAAGG - Intergenic
943312063 2:186338136-186338158 ACCCAGCCTCATTAAAAAGTGGG - Intergenic
944275224 2:197829875-197829897 TCCCTGCCTAATTATTAATGAGG - Intronic
946296514 2:218788043-218788065 TCTCTGCTTCATGATGGAGTGGG + Intronic
948093863 2:235317800-235317822 TTCCTGCCACATTGTGAAGCAGG - Intergenic
1169006101 20:2208111-2208133 ACCTTGCCTCATTAAAAAGTGGG + Intergenic
1169287792 20:4324140-4324162 TCCCTGCCTTATTCTGAAACTGG + Intergenic
1169640580 20:7746267-7746289 TTCCTGCCACCTTATGAAGAAGG - Intergenic
1172810183 20:37641792-37641814 TCTGTGCCTCATTATGAGGGTGG + Intergenic
1172829303 20:37819426-37819448 TACCTGCCTCATTATGAATAGGG + Intronic
1173290167 20:41707870-41707892 TCACAGCCTCATGATGAAGAGGG + Intergenic
1173304090 20:41831487-41831509 TCCCTGCCCCATTGTGAGGCAGG - Intergenic
1173575060 20:44107601-44107623 TCCCTGAATCATTATGATGAGGG + Intergenic
1173956496 20:47037073-47037095 TTCCTGCCACCTTATGAAGAAGG - Intronic
1174379278 20:50146359-50146381 TCCCTACCTAAATGTGAAGTCGG + Intronic
1174651243 20:52127521-52127543 TTCCTGCCTCTTTGTGAAGAAGG + Intronic
1174661818 20:52220317-52220339 TTCCTGCCACTTTATGAAGAAGG - Intergenic
1175583962 20:60122609-60122631 TCCCTCCCTCATGATTCAGTTGG + Intergenic
1176669030 21:9714889-9714911 TCACCGCTTCATTATTAAGTTGG - Intergenic
1177619059 21:23563005-23563027 TCACTGCCTCCTTGTGAAGACGG + Intergenic
1177821268 21:26033330-26033352 TTCCTGCCGCCTTATGAAGAAGG + Intronic
1178468399 21:32869901-32869923 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1184568647 22:45308868-45308890 TTCCTGCCTGATTTTAAAGTTGG - Intergenic
949135475 3:559856-559878 ACCCAGCCTCATAATGAAGAAGG - Intergenic
950464329 3:13144382-13144404 TCCCTGCCTCCCTCTGATGTGGG - Intergenic
954077073 3:48188921-48188943 TCCCTCCCTCATTATAAAATGGG - Intergenic
954832143 3:53430615-53430637 TCACTGCCTCATTAGGAAGCAGG - Intergenic
955146551 3:56325757-56325779 TCCCAACCACTTTATGAAGTGGG + Intronic
955948305 3:64216826-64216848 TGCCTGCCTCATTAGGAAGGAGG - Intronic
957561428 3:81826635-81826657 TTCCTGCCACATTGTGAAGAAGG + Intergenic
958442118 3:94168166-94168188 TCCCTTCTTTATCATGAAGTTGG + Intergenic
958522642 3:95211283-95211305 TCCTTGCCTACTTCTGAAGTTGG + Intergenic
959302325 3:104618980-104619002 TTCCTGCCGCCTTATGAAGAAGG + Intergenic
959376913 3:105599302-105599324 TCTGTGCCTCATTGGGAAGTTGG - Intergenic
960742158 3:120846280-120846302 TCCCTGCCTCACTGGGATGTGGG + Intergenic
964427664 3:156570080-156570102 CTCCTGCCACTTTATGAAGTAGG + Intergenic
965057259 3:163737647-163737669 TCCCTACCTCTTCCTGAAGTTGG + Intergenic
966971315 3:185048035-185048057 TCCCTGTCTCATTATAAAGCTGG - Intronic
969214804 4:5712929-5712951 CCCCTGCCTCACTGTAAAGTGGG - Intronic
969519777 4:7669351-7669373 TCACTTCCTCATCAAGAAGTGGG + Intronic
972399895 4:38691008-38691030 TCCCTACCTGCTGATGAAGTCGG - Intronic
972409151 4:38775043-38775065 ACTCTTCCTCATTATGAAGAAGG - Exonic
974125549 4:57691962-57691984 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
974728773 4:65834266-65834288 TCCCTGCCACCTTGTGAAGAAGG - Intergenic
975302191 4:72802896-72802918 TTCCTGCCACCTTATGAAGAAGG - Intergenic
977328723 4:95609745-95609767 CCACAGCCTCATTATGAAGGAGG - Intergenic
977919600 4:102628204-102628226 TCCCTGCCTCATAATTTAGGTGG - Intergenic
978902806 4:113972805-113972827 TCCCTGCCATATTTTCAAGTTGG + Intronic
980214035 4:129828049-129828071 CCTCTGCCTCATTTTCAAGTTGG + Intergenic
980338781 4:131513613-131513635 TTCCTGCCACCTTATGAAGAAGG + Intergenic
983409747 4:167381140-167381162 TCCCTCCCCCATGAGGAAGTGGG + Intergenic
984425813 4:179583959-179583981 TCACTGCCTCATGTTGAAATTGG - Intergenic
985405752 4:189636630-189636652 TCACCGCTTCATTATTAAGTTGG + Intergenic
988165078 5:27577838-27577860 TGCTTTACTCATTATGAAGTAGG + Intergenic
989189982 5:38661216-38661238 TCCCTTACTCATTTTAAAGTGGG + Intergenic
990849934 5:60191470-60191492 TTCCTGCCTCCTTGTGAAGAAGG + Intronic
992191231 5:74294163-74294185 TCCCTGCTTCTTTTTAAAGTTGG + Intergenic
993927470 5:93887179-93887201 TGCATTCCTCATTATCAAGTTGG + Intronic
995469235 5:112482921-112482943 TGCCTGTGTCATTATGCAGTAGG + Intergenic
996856309 5:128011498-128011520 TCCCTGAGTCATTATCAAATGGG - Intergenic
998347706 5:141478593-141478615 TTCCTTCCTCAATATGATGTAGG - Intronic
1002718429 5:181243544-181243566 TCTCTGCCCCATTGTGAATTGGG - Intronic
1002958084 6:1888364-1888386 TTCCTGCCGCCTTATGAAGAAGG - Intronic
1003703490 6:8496953-8496975 TCCCAGCACCATTATTAAGTAGG + Intergenic
1004471778 6:15935926-15935948 TCCCAGCCTCATTTTCAAGGTGG + Intergenic
1007710771 6:43822623-43822645 ACCCTCTCTCATTATGTAGTTGG - Intergenic
1008151836 6:47962604-47962626 TCCCTGCCACCTTGTGAAGAAGG + Intronic
1008813100 6:55529162-55529184 TCCCAACATCATTCTGAAGTAGG + Intronic
1010574045 6:77510516-77510538 TCCCTGCCACATTCTGAACAGGG + Intergenic
1013858999 6:114610791-114610813 TTCCTGCCTCCATATGAAGAGGG + Intergenic
1015076504 6:129164962-129164984 TCATTCCCCCATTATGAAGTTGG - Intronic
1015214838 6:130737659-130737681 TTCCTGCCACCTTATGAAGAAGG - Intergenic
1015285682 6:131484392-131484414 TCCCTCACTCAGTATGATGTTGG + Intergenic
1015344492 6:132139768-132139790 TCCCTGCTTAAATATGAACTTGG + Intergenic
1015368125 6:132420383-132420405 ACCCAACCTCATTATAAAGTGGG - Intergenic
1015481095 6:133710811-133710833 TCCCTGCCGCCATATGAAGAAGG - Intergenic
1015822702 6:137280870-137280892 TCCCTGCTTCATCCTGAACTCGG - Intergenic
1016828042 6:148406049-148406071 ACCCTGCCCCATTCTGAAATCGG - Intronic
1016832119 6:148444533-148444555 TCCCTACCCCATTATGAGTTTGG + Intronic
1017484378 6:154889525-154889547 TCACTACCTCATTATGAGATTGG - Intronic
1020334155 7:7048859-7048881 TTCCTGCCACCTTATGAAGAAGG + Intergenic
1020712172 7:11620978-11621000 TACCAGCCTCATAATGAAATGGG + Intronic
1021424028 7:20478584-20478606 TCCCTTCTTCAATATGAAGTGGG - Intergenic
1022326023 7:29332698-29332720 TCAATACTTCATTATGAAGTAGG + Intronic
1022818957 7:33939698-33939720 TCCCTGCCACCTTGTGAAGAAGG + Intronic
1027814403 7:82950736-82950758 CTCCTGCCTCATCATGAACTGGG + Exonic
1028041630 7:86060975-86060997 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1033863357 7:145658543-145658565 TCCCTGACTAGTTATGAGGTAGG - Intergenic
1038371213 8:26993337-26993359 TCCCTGCATGAAGATGAAGTAGG + Intergenic
1039378113 8:37057795-37057817 CTCCTGCCTCCTTATGAAGAAGG + Intergenic
1041368168 8:57131092-57131114 TCCCTCCCTCATTGTGGAGGAGG - Intergenic
1042674931 8:71309752-71309774 TCCCTGCCTCATTATGAAGTGGG - Intronic
1042759359 8:72253831-72253853 TCCCTGCCTGCCTATGAAATAGG - Intergenic
1043321197 8:78988870-78988892 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1045773924 8:105779221-105779243 ACTCTGCCTCAATATAAAGTAGG - Intronic
1048115910 8:131521793-131521815 TCACTTCATCTTTATGAAGTGGG + Intergenic
1049737538 8:144217821-144217843 TCCCTACCTCTTTATCCAGTAGG + Intronic
1053104651 9:35399333-35399355 TCCCTGCTTCCTGATGGAGTTGG + Intronic
1055029513 9:71759495-71759517 TCTGTGCCTCATTGGGAAGTTGG - Intronic
1056477728 9:86969066-86969088 TCCCTGACACATTATAATGTAGG - Intergenic
1059315954 9:113426079-113426101 TCCCTGCCTCATTGGAAAATGGG - Intronic
1059939509 9:119344207-119344229 TCCCTGCTGCCTTCTGAAGTAGG - Intronic
1060264935 9:122106190-122106212 TTCCTGCCACCTTATGAAGAAGG - Intergenic
1060895369 9:127213530-127213552 TCCCAGCATGATCATGAAGTGGG - Intronic
1061639143 9:131937630-131937652 TCCCACCCTCATTATGAAATGGG + Intronic
1203656837 Un_KI270753v1:6046-6068 TCACTGCTTCATTATTAAGTTGG + Intergenic
1186004724 X:5056753-5056775 TTCCTGCCGCCTTATGAAGAAGG + Intergenic
1186299652 X:8186045-8186067 TTTCTGCCTCATTATGAAACTGG + Intergenic
1186803540 X:13117216-13117238 TCCCTCCCTCATTGAGGAGTTGG + Intergenic
1186919158 X:14258938-14258960 TCCCTTCCCCATTTAGAAGTAGG + Intergenic
1187006268 X:15235694-15235716 TCCCTGTCTCATTAGACAGTGGG + Intronic
1189082747 X:37991851-37991873 GCCCTGCCTTATTATGAAAGCGG + Intronic
1193911381 X:87310586-87310608 TCCCTGCCGCCTTGTGAAGAAGG - Intergenic
1195448284 X:104978086-104978108 TTCTTGGCTCATTATGAGGTAGG - Intronic
1195672683 X:107483080-107483102 TCTCAGCCTCAGTATGGAGTAGG + Intergenic
1195726370 X:107921599-107921621 TCCCTCCCACATTTTCAAGTTGG + Intronic
1196306431 X:114108408-114108430 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1198146766 X:133865444-133865466 TACGTAGCTCATTATGAAGTAGG - Intronic
1198932035 X:141872147-141872169 GCCATTCCTCGTTATGAAGTTGG + Intronic
1199116201 X:143996143-143996165 AACCAACCTCATTATGAAGTAGG + Intergenic
1199346723 X:146748959-146748981 TTCCTGTCTCATTGTGAAGAAGG - Intergenic