ID: 1042675215

View in Genome Browser
Species Human (GRCh38)
Location 8:71313015-71313037
Sequence ACCAAGTCCTTGTTGGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042675215 Original CRISPR ACCAAGTCCTTGTTGGTCAT GGG (reversed) Intronic
900856465 1:5189179-5189201 ACCATGACCTTGTAGGTCATGGG - Intergenic
900919636 1:5662189-5662211 ACCAAGACCTCGGTGGGCATGGG + Intergenic
903093899 1:20950473-20950495 ACCAAATCCTTCTTGGTCTTTGG - Intronic
906642975 1:47452564-47452586 TCCAAGTGCTTGTTGGGGATAGG + Intergenic
913375202 1:118143935-118143957 ACCCAGTCCTTGTGTGGCATGGG + Intronic
924285211 1:242478642-242478664 ACCAAGTCCCATTTGTTCATGGG + Intronic
1063121699 10:3109326-3109348 ACCAGGTCCATGTGGGTCAGGGG - Intronic
1063779312 10:9303317-9303339 AGCAAGTCCTTGGTGGCAATAGG + Intergenic
1066245622 10:33580868-33580890 ACCAAGGCCATGATGCTCATGGG + Intergenic
1067903347 10:50264877-50264899 AGCAAGTCCTGGTTGGTGTTGGG + Intergenic
1070149003 10:73794030-73794052 ACCAAGGCCTTGGAGGTCAGAGG + Exonic
1070965771 10:80529408-80529430 TCCACCTCCTTGTTGGACATAGG - Exonic
1072435009 10:95406856-95406878 ATCAAGACCTTGCTGGTCCTTGG + Intronic
1073890167 10:108091637-108091659 CCCAAGGGCTTTTTGGTCATGGG - Intergenic
1074437913 10:113450103-113450125 ACAAAGTCCGTCTTTGTCATGGG - Intergenic
1074769858 10:116726239-116726261 ACAAAGTCATGGCTGGTCATGGG - Intronic
1089281324 11:117376744-117376766 ACCAGGTCCTTGTTGGATCTTGG + Intronic
1090137148 11:124210154-124210176 TCCAAGTCCTTGCTGGGCCTGGG + Intergenic
1093494972 12:19746153-19746175 ACCAAGTCGCTGTTGCTCCTGGG - Intergenic
1098450506 12:70613215-70613237 ACCATGACCTTTTAGGTCATGGG - Intronic
1101477769 12:105066701-105066723 ACCATGCCATTGTTGATCATTGG - Intronic
1104425323 12:128672257-128672279 CACAGGTCCTTGTTGGTCACTGG + Intronic
1108790077 13:53959207-53959229 ACCAGGTCCATGTTGGTTAGTGG + Intergenic
1110583068 13:77155314-77155336 ACAAAATCCTTTTTGCTCATTGG - Intronic
1112802412 13:103126953-103126975 ACCAACCCCTTGTAGGTTATTGG - Intergenic
1113190743 13:107742772-107742794 GCCAAGTCCATTTTGCTCATGGG + Intronic
1119169445 14:72523135-72523157 TGCAAGTCCTGGCTGGTCATGGG - Intronic
1119394659 14:74317480-74317502 ACCAAGTAATTATTTGTCATGGG - Intronic
1128480062 15:68029570-68029592 ATCAAGACCTTGTTGATCTTGGG - Intergenic
1139105692 16:63824002-63824024 AACTTGTCCTTGTTGGTCCTTGG - Intergenic
1142661366 17:1431965-1431987 ATGAAGTCTTTGTTGTTCATTGG - Intronic
1148590556 17:48813639-48813661 TCCAAGCCCTTGTTGGAGATGGG - Intronic
1149561128 17:57608652-57608674 TCCTAGTCATTGTTGGTCAAAGG + Intronic
1149982911 17:61325499-61325521 ACCAATTCATTCTTGGTCAGTGG + Intronic
1152172165 17:78758752-78758774 GCTAAGTCCTTGGTGGTCCTTGG + Intronic
1161366608 19:3883551-3883573 ACCCAGTCATTCTTGGTCATGGG + Intronic
1161794770 19:6380414-6380436 AGCAGGTCCTTAGTGGTCATGGG + Exonic
1163809483 19:19421666-19421688 TCCTAGTCCGTGTTGGACATGGG + Intronic
1165901713 19:39172440-39172462 CCCCACTCCTTGTTGTTCATGGG + Intronic
1166956909 19:46470950-46470972 CACAGGTCCTTGTTGGTCACAGG - Exonic
928301868 2:30132222-30132244 ACCAAGTCCTTGCCCTTCATGGG - Intergenic
929878271 2:45814927-45814949 ACCAACACCTTGTTGGTTTTTGG - Intronic
932751766 2:74375813-74375835 ACCAGCTCCTGGTTGGTGATGGG - Intronic
937780704 2:125833822-125833844 TCCTTGTCCTTGGTGGTCATTGG - Intergenic
939678826 2:145105729-145105751 AGCAGGTCCTGATTGGTCATGGG + Intergenic
943538743 2:189184921-189184943 ATTAATTCCTTGTCGGTCATGGG + Intergenic
943951530 2:194135796-194135818 CCCAAGTCCTTGATGGACACCGG + Intergenic
944606405 2:201355515-201355537 ACCAAGACATTGTTTATCATGGG - Intronic
944900535 2:204209702-204209724 TTCAAGTGCTTATTGGTCATTGG + Intergenic
945493245 2:210480170-210480192 ATCAAGTCCATGCTGGTCATAGG + Intronic
945673776 2:212832194-212832216 AACAAGTTCGTGGTGGTCATGGG + Intergenic
946504643 2:220285694-220285716 TTCAACTCCTTGTTGTTCATGGG + Intergenic
1170494829 20:16914817-16914839 TCCAAGTCCTTGCTGGGCCTGGG - Intergenic
1170861100 20:20104657-20104679 ACTAAGTCCTGGTGGGTCACTGG - Intronic
1174850502 20:53989420-53989442 ACCAAGACTTTCTTGGTCTTAGG - Intronic
1175498179 20:59429583-59429605 GCCATTTCCTTCTTGGTCATGGG + Intergenic
1183673999 22:39289824-39289846 ACCGAGTCCCTGTGGGTCTTGGG + Intergenic
1184996686 22:48212237-48212259 ATCCAGTCCCTGTTGGTTATTGG - Intergenic
951226621 3:20128100-20128122 ACCAAGGCTTTGTTGGACTTTGG + Intronic
951801057 3:26596461-26596483 ACCAAGTCCCTGTCAGTCACCGG + Intergenic
951812562 3:26716722-26716744 ACCAAGTTCTTAGTAGTCATCGG - Intergenic
952707107 3:36390545-36390567 AACAAGTCCTGCTTGGCCATGGG + Intronic
953189384 3:40669523-40669545 ACACAGACCTTGGTGGTCATAGG + Intergenic
953791414 3:45950605-45950627 GCCTAGTCCTTGTTGGTCCCTGG + Intronic
954574757 3:51669881-51669903 ACCATGTGCTTGATGTTCATAGG + Intronic
958181073 3:90061650-90061672 ACTATCTCCTTTTTGGTCATGGG - Intergenic
960348078 3:116559460-116559482 ATCAAATGCTTGATGGTCATGGG + Intronic
960620722 3:119634154-119634176 ACAAAGTCCCTGTTGGTCAAGGG - Intergenic
962637721 3:137348162-137348184 ACCAAGTCCCTGTCTGTCACTGG - Intergenic
963668534 3:148221935-148221957 GCAAAGTCCTTGGTGGGCATAGG - Intergenic
964197344 3:154079988-154080010 AAGAAGTCCTGGTTGGACATCGG + Intergenic
975319348 4:72993105-72993127 TCCAAGTCCTTCTTGGGCATAGG - Intergenic
977701636 4:100029066-100029088 ACCATGGCCATGTTGTTCATGGG + Intergenic
979734465 4:124065320-124065342 AGCAAGTCCTTGAGGGTGATGGG + Intergenic
986601286 5:9475402-9475424 ACCGTGTCCTTCTTAGTCATGGG + Intronic
987584555 5:19837668-19837690 ACCCAGTCCCTGTTGGACAAGGG + Intronic
988104132 5:26721730-26721752 AGCAATTCCTTGTTATTCATAGG + Intergenic
988584276 5:32495244-32495266 ACCAACTCTTTGTTGGCCAAAGG + Intergenic
990972473 5:61524186-61524208 ACCAATTTCTTGCTGGGCATGGG + Intronic
993681713 5:90886265-90886287 ACCCACTCCTGGTTGGTCTTTGG + Intronic
996292035 5:121862912-121862934 TCCCACTCCTTGTTGGGCATTGG - Intergenic
997626109 5:135331549-135331571 AGTAAGTCCTTGTTGATCACTGG + Intronic
1006038073 6:31229748-31229770 TCCAAGTCCATGGAGGTCATGGG - Intergenic
1007720928 6:43885064-43885086 TCCATGTCTTTGTTGGCCATTGG + Intergenic
1007843103 6:44732591-44732613 TCCATGTCCTTGTCGGCCATGGG - Intergenic
1007843191 6:44733444-44733466 CGCATGTCCTTGTTGGCCATGGG - Intergenic
1008883505 6:56406813-56406835 ACCACGTACTAGCTGGTCATTGG + Intergenic
1010196114 6:73241674-73241696 ACCAGGTCATCGTTGGTCAGAGG + Exonic
1019083636 6:169454241-169454263 ACCATTTGCATGTTGGTCATTGG + Intergenic
1020145084 7:5636000-5636022 ACAAAGTCCGTGTTTGTCTTGGG - Intronic
1022654049 7:32302653-32302675 GGCAAGTTCTTGTTGCTCATTGG + Intergenic
1024726182 7:52198548-52198570 ACAATGTCCTTGTTTGGCATTGG + Intergenic
1030901883 7:115134817-115134839 ACCAAGTCCTTTTTGGAAATGGG + Intergenic
1031475329 7:122214149-122214171 AACAAGTCCTTTTTTGTCTTTGG - Intergenic
1032920672 7:136542828-136542850 ACCATGCCCTTCTTGGTCAGTGG + Intergenic
1034883546 7:154780247-154780269 ACAAAGTTCCTGTTGATCATGGG + Intronic
1037931210 8:22881311-22881333 CACAAGTCCTTGTAGGTGATAGG - Intronic
1042675215 8:71313015-71313037 ACCAAGTCCTTGTTGGTCATGGG - Intronic
1043936555 8:86149076-86149098 ACCATGTCTTTCTTGTTCATTGG - Intronic
1044147291 8:88732928-88732950 ACCAGTTCCTTGTGGGTAATGGG - Intergenic
1049985005 9:942126-942148 ACCAAGGCCTAGATGGTCATGGG - Intronic
1050431244 9:5564150-5564172 ACCAACTACTATTTGGTCATTGG + Intronic
1060550593 9:124483099-124483121 CCCATGTCTTTGATGGTCATAGG - Intronic
1060967107 9:127717515-127717537 ACCAAGTCCCTGATGGGAATTGG + Intronic
1185876948 X:3709573-3709595 ACCCAGTGCTTGCTTGTCATGGG - Intronic
1186113725 X:6283034-6283056 ACCAGCTTCTTGTTGGTTATGGG + Intergenic
1186799830 X:13081688-13081710 TGCAAGGCCTTGTTGATCATGGG + Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189782751 X:44531728-44531750 ACCAAGTCCCTGTTTGTCTAAGG - Intronic
1191863960 X:65689133-65689155 ACCAAGTCCTTGCTCGTTTTTGG + Intronic
1192183055 X:68928395-68928417 ACCCGGGCCTTGTAGGTCATTGG - Intergenic
1199133652 X:144225485-144225507 ACAAAGTCTTTGTTGCTTATAGG + Intergenic
1199545975 X:149007788-149007810 ACCCTGCCCTTGTTGGTCATGGG + Intergenic
1200788364 Y:7278339-7278361 ACCCAGTGCTTGTTTCTCATGGG + Intergenic
1202193268 Y:22267280-22267302 ACCAAGACCATGATGGTCACAGG + Intergenic