ID: 1042683655

View in Genome Browser
Species Human (GRCh38)
Location 8:71414063-71414085
Sequence GGGCAGCTGAAGCTTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 618}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683655_1042683668 26 Left 1042683655 8:71414063-71414085 CCTCCAGGAAGCTTCAGCTGCCC 0: 1
1: 0
2: 3
3: 56
4: 618
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683655_1042683666 21 Left 1042683655 8:71414063-71414085 CCTCCAGGAAGCTTCAGCTGCCC 0: 1
1: 0
2: 3
3: 56
4: 618
Right 1042683666 8:71414107-71414129 TTATCCTGAGTAGGAGCTACAGG No data
1042683655_1042683665 12 Left 1042683655 8:71414063-71414085 CCTCCAGGAAGCTTCAGCTGCCC 0: 1
1: 0
2: 3
3: 56
4: 618
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683655 Original CRISPR GGGCAGCTGAAGCTTCCTGG AGG (reversed) Intronic
900004072 1:32716-32738 GGGCTGCAGAGGCTTCCTAGAGG - Intergenic
900023800 1:203236-203258 GGGCTGCAGAGGCTTCCTAGAGG - Intergenic
900075881 1:817472-817494 TGGCAGCAGAAGCTTCCTCTGGG + Intergenic
900420327 1:2553401-2553423 GGGCAGCTGGGGCTTCCCAGAGG - Intergenic
900424099 1:2568257-2568279 GGGCAGCTGGGGCTTCCCAGAGG + Intergenic
900702123 1:4054984-4055006 AGACAGATGAGGCTTCCTGGAGG + Intergenic
901202850 1:7476396-7476418 GGTCAGGGGAGGCTTCCTGGAGG + Intronic
901610586 1:10494812-10494834 GGGCAGCTGGGGCCCCCTGGTGG + Intronic
902285216 1:15403920-15403942 GAGCAGGTGGAGGTTCCTGGAGG - Intergenic
902385977 1:16076214-16076236 TGGCAGCTGATGCTCCCTGCTGG + Intergenic
903337629 1:22635512-22635534 AGGCAGCTGCAGCTGCATGGGGG + Intergenic
903774392 1:25783401-25783423 GGGCAGGTGAAGCTGGCTGATGG + Intronic
904002210 1:27345290-27345312 GGGCACACGGAGCTTCCTGGGGG - Exonic
904032372 1:27541193-27541215 AGGCAGCAGGAGATTCCTGGAGG - Intronic
904377383 1:30090360-30090382 GGGCAGCCGGAGCATCCTGAGGG + Intergenic
904940160 1:34160109-34160131 GTGCTGCTGAAGCTGCCTGCTGG + Intronic
905928264 1:41767449-41767471 GAGCAGCTGAGGCTTCCCAGAGG + Intronic
905952715 1:41965142-41965164 GGGCTGCTGCAGTTTTCTGGGGG - Intronic
906225008 1:44114459-44114481 GTGCAGCAAAGGCTTCCTGGAGG + Intergenic
907278201 1:53328351-53328373 AAGCAGCAGAGGCTTCCTGGAGG + Intergenic
909051498 1:70773752-70773774 GGTCAGCTGCAGCTTGTTGGAGG + Intergenic
909384335 1:75037553-75037575 GGTCTGCTGCAGTTTCCTGGAGG - Intergenic
909532299 1:76694473-76694495 GGGCAGTTGCAGGTTCCTGGTGG + Intergenic
909677914 1:78258026-78258048 GGGCTGCTGCAGTTTTCTGGGGG - Intergenic
909806273 1:79876565-79876587 GGGCAACTTCAGCTTGCTGGAGG - Intergenic
910149568 1:84126059-84126081 GTCCAGTGGAAGCTTCCTGGGGG + Intronic
910483337 1:87682747-87682769 TGCCAGCTGAAGCTTCTGGGTGG - Intergenic
910514027 1:88037665-88037687 CGACAACTGAAGCTTGCTGGAGG - Intergenic
911508635 1:98784595-98784617 GGGCTGCTGCAGTTTTCTGGGGG - Intergenic
911982849 1:104587249-104587271 GGTCTGCTGGAGCTTGCTGGAGG - Intergenic
912254402 1:108044371-108044393 GGGGAGTAAAAGCTTCCTGGAGG + Intergenic
912893276 1:113557945-113557967 GGGCTGCTGGAGCGTGCTGGGGG - Intronic
915140250 1:153763480-153763502 AGGTAGCTGAAGCTTCATGAGGG + Intronic
915639702 1:157215370-157215392 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
916218493 1:162419811-162419833 GAGCAGCTGAGGCTTGCTGAAGG - Intergenic
916400517 1:164443064-164443086 AGGCAGATGAAACTTTCTGGGGG - Intergenic
916568947 1:166008398-166008420 GGGCTGCTGCAGCATGCTGGGGG + Intergenic
917003790 1:170388882-170388904 GGGCAACTACAGCTTGCTGGAGG + Intergenic
917060467 1:171032537-171032559 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
917149383 1:171928589-171928611 GGTCAACTGCAGCTTGCTGGAGG + Intronic
917305308 1:173618020-173618042 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
917582274 1:176391324-176391346 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
918472416 1:184887503-184887525 TGGCATATGAAACTTCCTGGAGG + Intronic
919586535 1:199447408-199447430 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
919792365 1:201300390-201300412 GGGCAACAGAAGCTTCTTAGGGG - Intronic
920916524 1:210262251-210262273 AGGCAGCTGGAGCTGCCAGGAGG - Intergenic
921736318 1:218633050-218633072 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
921943039 1:220863389-220863411 GGTCTGCTGAAGTTTGCTGGAGG + Intergenic
922241010 1:223755550-223755572 GAGCGGCTGCACCTTCCTGGTGG + Exonic
922399520 1:225238371-225238393 GGGCAGCTGCAGTTTATTGGAGG + Intronic
923195418 1:231662002-231662024 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
923199184 1:231694905-231694927 GAGCTGCTGCAGCTTCCAGGAGG - Intronic
923215534 1:231845027-231845049 ATGCAGCTGAAGCCTCCAGGTGG + Intronic
924412434 1:243819880-243819902 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
1063150493 10:3332230-3332252 GCGTAGCTGTAGCTTCCAGGCGG - Intergenic
1064015108 10:11765561-11765583 GGGCAGCTCAAGAATCCTGCAGG + Intergenic
1065201568 10:23317398-23317420 GGGCAGCTGCAGCTGCCTCTAGG + Exonic
1065553530 10:26892121-26892143 GTGCAGCTGCATCTTCCTGCTGG - Intergenic
1065589323 10:27249965-27249987 GCTCAGCTGCAGCTTCCTGCTGG + Intergenic
1065599632 10:27355500-27355522 GTGCAGCTGCATCTTCCTGCTGG + Intergenic
1066157954 10:32698077-32698099 GGTCTGCTGGAGCTTGCTGGAGG - Intronic
1067207570 10:44233078-44233100 GGGCTGTTGAAGTTTGCTGGGGG + Intergenic
1067329346 10:45300798-45300820 GGTCTGCTGAAGTTTGCTGGGGG + Intergenic
1069616601 10:69810600-69810622 GGACTTCTGAGGCTTCCTGGAGG - Intronic
1070164576 10:73887985-73888007 GAGGAGATGAAGCTGCCTGGGGG + Intergenic
1070682332 10:78457220-78457242 GGGCAGCTGCAGCAGCCTGCAGG - Intergenic
1071059164 10:81548988-81549010 GGGCTGCTGTAGTTTGCTGGGGG - Intergenic
1071134469 10:82437812-82437834 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1071272509 10:84020781-84020803 GGTCTGCTGAAGTTTGCTGGAGG - Intergenic
1072319245 10:94232851-94232873 GGCTAGCTGGAGCTCCCTGGTGG - Intronic
1072854742 10:98935554-98935576 GGTCTGCTGCAGCTTGCTGGGGG + Intronic
1073572710 10:104594061-104594083 GGGTAGCGTAAGCTTCCTGAGGG + Intergenic
1074722346 10:116273528-116273550 GTGCAGCTGCGGCTGCCTGGCGG - Intergenic
1074735707 10:116430458-116430480 GTGCAGCTGAATGTGCCTGGAGG - Intronic
1075424044 10:122327853-122327875 CGGCGTCTGGAGCTTCCTGGTGG + Intronic
1075602564 10:123781169-123781191 TGGGAGCTGAAGCACCCTGGCGG + Intronic
1075746861 10:124734054-124734076 GGGCAGGGAAGGCTTCCTGGAGG - Intronic
1076185232 10:128441249-128441271 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1076584308 10:131534910-131534932 GAGCAGCTGCTGCTTCCTGGTGG + Intergenic
1077062899 11:625551-625573 GGGCAGCTGGGAGTTCCTGGGGG + Intronic
1077118252 11:895162-895184 GGGAAGCTGACCCTACCTGGGGG + Intronic
1077416403 11:2426237-2426259 GGGCAGCCTCACCTTCCTGGTGG + Intergenic
1078428974 11:11272710-11272732 GGGCAGTAGAGACTTCCTGGAGG - Intronic
1078501761 11:11885974-11885996 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
1079281596 11:19091562-19091584 GGGCAGTAGGAGCTTCCTTGAGG + Intergenic
1079621962 11:22566574-22566596 GGGCAGTTACAGCTTGCTGGAGG + Intergenic
1079869673 11:25781448-25781470 GGGGAACTGCAGCTTGCTGGAGG - Intergenic
1080130798 11:28792563-28792585 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1080365947 11:31574280-31574302 ACTCAGCTCAAGCTTCCTGGAGG - Intronic
1080710064 11:34738126-34738148 GGGAAGCTGGAGCTTGGTGGGGG + Intergenic
1081143744 11:39536051-39536073 GGTCAGCTGGAGTTTCCTGGAGG + Intergenic
1081343723 11:41957113-41957135 GGGCAACTGCAGCTTGCTGGAGG - Intergenic
1081742922 11:45453563-45453585 GTGAAGCTGCAGCTTACTGGAGG + Intergenic
1082283704 11:50298465-50298487 GGGCTGCTGGGGCTTCCAGGAGG - Intergenic
1082872035 11:57952804-57952826 GGTCTGCTGAAGTTTGCTGGAGG + Intergenic
1082903516 11:58282578-58282600 GGTCTGCTGGAGTTTCCTGGAGG + Intergenic
1083149286 11:60781803-60781825 GGCCAGATAAGGCTTCCTGGAGG - Intergenic
1083209387 11:61173516-61173538 GGGCAGCTGCAGCCACCTGGAGG - Intergenic
1083349755 11:62019123-62019145 GGTAAGCAGGAGCTTCCTGGAGG + Intergenic
1085003479 11:73062182-73062204 GGTCTGCTGAAGTTTGCTGGAGG - Intronic
1085274431 11:75289335-75289357 GGGCAGCGGCAGCTTCTAGGAGG - Intronic
1085741312 11:79080420-79080442 GGGCAGCAGAGGCTGCCTGAAGG + Intronic
1085764706 11:79272751-79272773 GGCCAGGGGAAGCTTCCAGGAGG - Intronic
1086279850 11:85172345-85172367 GAGCTGCTGCAGTTTCCTGGGGG - Intronic
1086822129 11:91446883-91446905 GGGCAATTGCAGCTTGCTGGAGG - Intergenic
1087181671 11:95148339-95148361 GGGCAGTTGATGCTTGCTGTTGG + Intergenic
1087695205 11:101369073-101369095 GGTCTGCTGGAGTTTCCTGGAGG + Intergenic
1088383290 11:109220959-109220981 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1088594190 11:111427731-111427753 GGGTAGCTGCAGCTTCTGGGTGG - Intronic
1088697824 11:112383251-112383273 GGGCTGCTGCAGTTTGCTGGAGG - Intergenic
1088908469 11:114172332-114172354 TGGCAGCTGACATTTCCTGGAGG + Intronic
1089296002 11:117468677-117468699 GGGCAGCTGGTCCTTCCTGGGGG - Intronic
1089300536 11:117496086-117496108 GGTCAGATGGAGCTTCCCGGAGG - Intronic
1089649243 11:119901669-119901691 AGGCAGGTGCAGCTTCCAGGAGG + Intergenic
1090417578 11:126551170-126551192 GAGCATGTAAAGCTTCCTGGAGG - Intronic
1091085324 11:132716122-132716144 CTGCTGCTGAAGCTGCCTGGAGG + Intronic
1091377497 12:34768-34790 GGGCTGCAGAGGCTTCCTAGAGG - Intergenic
1092304466 12:7284427-7284449 GGTCTGCTGAAGTTTGCTGGAGG - Intergenic
1092443073 12:8526957-8526979 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1092512485 12:9171236-9171258 GGGCTGCTGAGGTTTGCTGGGGG - Intronic
1093383254 12:18521010-18521032 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1093522598 12:20067632-20067654 GGGCTGCTGCAGTTTGCTGGTGG - Intergenic
1094054727 12:26257029-26257051 GGGCTGCTGCAGTTTACTGGGGG - Intronic
1094249765 12:28346711-28346733 GGACACATGAAGGTTCCTGGAGG - Intronic
1094275427 12:28669299-28669321 GGGCTGCTGCAGTTTTCTGGGGG - Intergenic
1097281366 12:57846851-57846873 GGCCAGCTGGAGCTTCCCGCTGG + Intergenic
1097341515 12:58443737-58443759 GGGCAAATGATGCCTCCTGGTGG + Intergenic
1097529434 12:60780425-60780447 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1097643020 12:62205087-62205109 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1098632492 12:72740969-72740991 GGGCAACTGCAGCTTGCTGGAGG - Intergenic
1098830052 12:75350582-75350604 GGGCTGCTGTGGTTTCCTGGGGG - Intronic
1099544135 12:83955420-83955442 AGGCAGATGAAGCCTCCAGGTGG - Intergenic
1099684216 12:85865466-85865488 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1100156493 12:91805345-91805367 GGGCTGCTGTGGTTTCCTGGGGG - Intergenic
1100414412 12:94356808-94356830 GGGCAGATGAAGCTTCCATTTGG + Intronic
1101042627 12:100772025-100772047 GGGAAACTGACTCTTCCTGGAGG + Intronic
1101442144 12:104711870-104711892 AGGCAGAAGAAGCTTCCGGGAGG + Intronic
1101845131 12:108357528-108357550 GGTCAGGGGAGGCTTCCTGGAGG + Intergenic
1102503404 12:113368484-113368506 GGGCAAGTGAGGCTTCCTGAAGG + Intronic
1102511856 12:113421342-113421364 GGGCTGGGGAGGCTTCCTGGAGG - Intronic
1103128549 12:118446340-118446362 GGGCAGCTGAAGAGGCCGGGAGG + Intergenic
1103582019 12:121922511-121922533 GGCCAGGGAAAGCTTCCTGGAGG + Intronic
1103728911 12:123013194-123013216 GGGCACCTGGAGCTTGCTGAGGG - Intronic
1104057119 12:125239092-125239114 GGTCAGGGAAAGCTTCCTGGAGG + Intronic
1104674849 12:130705457-130705479 GGGCCACAGAAGCCTCCTGGGGG + Intronic
1106238048 13:27882047-27882069 GGGCAAGAGAAGATTCCTGGTGG + Intergenic
1107435355 13:40376587-40376609 AGGCAGCAGAAGCTTCCTGCTGG - Intergenic
1108160500 13:47633192-47633214 GGGCTGCTGCAGTTTCCTGGGGG - Intergenic
1108173878 13:47772760-47772782 GGGCTGCTGCAGTTTCTTGGGGG + Intergenic
1108229388 13:48320392-48320414 GGGAACCTAAAGCTCCCTGGTGG + Intronic
1108858913 13:54829560-54829582 GTGCAGCTGGAGCCTCCTCGAGG - Intergenic
1109146793 13:58790051-58790073 GGGCTGCTGTGGTTTCCTGGGGG + Intergenic
1109308364 13:60664105-60664127 GGGCAGCTGCAGCCTCCTGGAGG - Intergenic
1109318684 13:60782583-60782605 GGTCAGCTGCAGCTTGCTGAAGG + Intergenic
1110790396 13:79581449-79581471 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1110804143 13:79735708-79735730 GGGCACCTGCAGCTTGTTGGAGG + Intergenic
1110923567 13:81120560-81120582 GGCCAGGAAAAGCTTCCTGGAGG - Intergenic
1110994239 13:82085364-82085386 GGGCTGCAGAAGCTTGATGGGGG + Intergenic
1111305747 13:86410240-86410262 GGGCTGCTGCAGTTTTCTGGGGG - Intergenic
1115339186 14:32273566-32273588 GGTCTGCTGTAGCTTGCTGGAGG - Intergenic
1117466415 14:55999327-55999349 GGTCTGCTGAAGTTTGCTGGAGG + Intergenic
1117857469 14:60050832-60050854 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1117930770 14:60838697-60838719 GGGCAGCTGCAGCTGCCAGCAGG - Intronic
1119124341 14:72111753-72111775 GGCCATTTGAAGCTTCCTTGAGG - Intronic
1119558102 14:75568683-75568705 GGGCAGCTGAAGCTGTCATGAGG + Intergenic
1120143791 14:80957231-80957253 GGTCAGGAGAAGCTTCCTGCAGG - Intronic
1121142507 14:91555531-91555553 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1122693218 14:103541238-103541260 GGGAAGCAGACGCTTCTTGGCGG + Intergenic
1123167097 14:106335722-106335744 GGGCAGATGAAGTGTCCTGGGGG + Intergenic
1123169714 14:106360433-106360455 GGGCAGATGAAGTGTCCTGGGGG + Intergenic
1123184470 14:106503200-106503222 GGGCATTTGCAGCTTCCTGGAGG + Intergenic
1123193481 14:106593314-106593336 GTGCAGATGAAGTGTCCTGGGGG + Intergenic
1123202114 14:106675655-106675677 GTGCAGATGAAGTCTCCTGGGGG + Intergenic
1123451042 15:20358782-20358804 GGGCGACTGAAGCCCCCTGGAGG + Intergenic
1124499283 15:30212425-30212447 GAGCTGCTCAAGCTCCCTGGTGG - Intergenic
1124744296 15:32326245-32326267 GAGCTGCTCAAGCTCCCTGGTGG + Intergenic
1125219621 15:37317983-37318005 GGTCTGCTGAAGTTTGCTGGAGG - Intergenic
1125227265 15:37409018-37409040 GGTCTGCTGAAGTTTGCTGGAGG - Intergenic
1126056729 15:44736689-44736711 GGTGGGCTGAAGCTTCATGGAGG + Exonic
1126233527 15:46354796-46354818 GGCCAGCTGCAGCTTGCTAGAGG - Intergenic
1126284492 15:46996067-46996089 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1126552899 15:49952972-49952994 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1126956336 15:53936758-53936780 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1127042453 15:54991460-54991482 GGGCTGCTGCAGTTTTCTGGGGG - Intergenic
1127099944 15:55553909-55553931 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
1128241088 15:66101439-66101461 AGTCAGGGGAAGCTTCCTGGAGG - Intronic
1129054614 15:72810132-72810154 TAGAGGCTGAAGCTTCCTGGAGG + Intergenic
1130030300 15:80308010-80308032 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1130736360 15:86554405-86554427 GAGCAGCTGCAGCTTTCTCGTGG + Exonic
1131143761 15:89999161-89999183 GGTCAGGTGTGGCTTCCTGGAGG - Intergenic
1131942661 15:97584720-97584742 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1132355492 15:101168396-101168418 GAGCAGCTGATGCTACCAGGTGG + Intergenic
1132381257 15:101368301-101368323 GGGCAGCGGAAGGTTCTTGTGGG + Intronic
1132405704 15:101540940-101540962 GGGGAGCTGGAGCTCTCTGGAGG + Intergenic
1132449431 15:101958225-101958247 GGGCTGCAGAGGCTTCCTAGAGG + Intergenic
1132831434 16:1930154-1930176 GGGCCGCAGACGCTTCCTGGTGG + Intergenic
1133775884 16:8894759-8894781 GTGCAGCTGGGGCCTCCTGGGGG - Intronic
1136088997 16:27904859-27904881 TGGCAGCTGCAGCCACCTGGAGG + Intronic
1136294101 16:29291960-29291982 TGGCAGCTCAAGCTTGTTGGGGG - Intergenic
1136645424 16:31609498-31609520 GGGCTGCTGCAGTTTGCTGGAGG - Intergenic
1136870399 16:33802551-33802573 GTGCAGATGAAGTGTCCTGGGGG - Intergenic
1137518461 16:49171308-49171330 CCTCAGCTGAAGCTTCCTTGTGG - Intergenic
1138415235 16:56867810-56867832 TGGAGGCTGAAGCTTCCAGGTGG - Intronic
1138454225 16:57112281-57112303 GGCCAGCTGAGGACTCCTGGGGG + Intronic
1138488701 16:57363620-57363642 GGGCTCCTGAGCCTTCCTGGAGG - Exonic
1138519356 16:57562251-57562273 GGGCCACTTAGGCTTCCTGGGGG + Intronic
1139310122 16:66021130-66021152 GGGTAGCCGAAGCCTCCTAGAGG - Intergenic
1139594358 16:67949495-67949517 GGGCAGCAGTGGCTTCATGGAGG + Intronic
1140047961 16:71454955-71454977 GGGCAGCTGCAGCCTCTGGGAGG + Intronic
1141089041 16:81117435-81117457 GGCCAGCTGGAGCGCCCTGGCGG - Intergenic
1142100004 16:88266006-88266028 TGGCAGCTCAAGCTTGTTGGGGG - Intergenic
1142130793 16:88430677-88430699 GGGCAGGTGCGGCTCCCTGGCGG + Intronic
1142311267 16:89315386-89315408 GGGCAGGTCACGCTTCCCGGTGG - Intronic
1142468548 17:149081-149103 GGGCTGGTGAAGCTTCATGAAGG - Intronic
1142814513 17:2414750-2414772 GAGCAGCTAATGCTGCCTGGTGG - Intronic
1143097032 17:4483602-4483624 AGGCAGGTGAGGCTTCCTGGAGG - Intronic
1143503921 17:7353515-7353537 GGGCACCCCAAGCTTCCTGGAGG + Exonic
1144616798 17:16783562-16783584 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1144638729 17:16926321-16926343 GGGGATCTGAATCCTCCTGGCGG + Intergenic
1144895896 17:18532111-18532133 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1145136320 17:20412121-20412143 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1145987984 17:29060519-29060541 GGGGAGCTGCAGCTGGCTGGGGG - Intergenic
1147232603 17:39030186-39030208 GCTCAGCTGCAGCTTCCTGCTGG - Intergenic
1147388440 17:40095353-40095375 GGGCAGCTGGGGGTTCCTGGAGG - Intronic
1148132337 17:45269709-45269731 GGGCACATGGAGGTTCCTGGAGG + Intronic
1148205440 17:45776875-45776897 AGGCAGCTACAGCCTCCTGGTGG - Intergenic
1149281271 17:55108255-55108277 GGGATGCTGGAGCTTGCTGGGGG - Intronic
1149609401 17:57949177-57949199 GGGCAGGGAAGGCTTCCTGGAGG - Intronic
1149627410 17:58089670-58089692 GTGCAGCTGCCTCTTCCTGGCGG + Exonic
1150190379 17:63232514-63232536 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1150196410 17:63304343-63304365 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1151554655 17:74840631-74840653 TGGCAGGTGAGGCATCCTGGAGG - Intergenic
1151939629 17:77284347-77284369 GGGCAGCTGCAGGATCCAGGGGG + Intronic
1152342593 17:79733556-79733578 GGGCAGCTTCACCTTGCTGGTGG - Exonic
1152565794 17:81099747-81099769 GGGTAGCTGAAGCCTCCTGGGGG + Intronic
1152832156 17:82504032-82504054 GGGGAGCTGAAGCTTCACGGGGG - Intergenic
1152844977 17:82594077-82594099 GGTCTTCTGATGCTTCCTGGAGG + Intronic
1152938122 17:83152403-83152425 TGACAGCTGACGCTGCCTGGGGG + Intergenic
1153858329 18:9173469-9173491 GGGCTGCTGTAGTTTGCTGGGGG + Intronic
1153976316 18:10271342-10271364 GGGCTGCTGCTGCTGCCTGGAGG + Intergenic
1154406783 18:14099120-14099142 GGGGAGGTGAGGCTTCCTGAAGG - Intronic
1155225465 18:23725723-23725745 GAGCAGCAGAAGCTGCCAGGTGG - Intronic
1155763001 18:29589408-29589430 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1157061854 18:44300754-44300776 GGTCAGTTGGAGCTTGCTGGAGG - Intergenic
1157167136 18:45368158-45368180 GGGCACCTGAAACTTTCTGCAGG + Intronic
1157178768 18:45477249-45477271 GGTCTGCTGGAGCTTGCTGGAGG + Intronic
1160059499 18:75516357-75516379 GAGCAGCCCAGGCTTCCTGGAGG + Intergenic
1160635824 19:74325-74347 GGGCTGCAGAGGCTTCCTAGAGG - Intergenic
1160895505 19:1400242-1400264 GGGCTGGGGAGGCTTCCTGGAGG + Intronic
1160993565 19:1871671-1871693 GGGCAGCTGCAAGCTCCTGGGGG + Intergenic
1161641386 19:5425604-5425626 GGTCAGGTGAAGCTTCCCTGAGG - Intergenic
1161653511 19:5499080-5499102 GTGCAGCTGAGGCTACCGGGTGG - Intergenic
1161992839 19:7694734-7694756 GGGCAGCTGGGGCTTCCCAGAGG + Intronic
1162578099 19:11511077-11511099 GGGCAGGTGGGGCTTCCTGGGGG - Intronic
1163872264 19:19831568-19831590 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1163886038 19:19965847-19965869 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1163888430 19:19989630-19989652 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1163949566 19:20571425-20571447 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1163958273 19:20664107-20664129 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1165940943 19:39414409-39414431 GGTCAGGGGAAGGTTCCTGGAGG + Intronic
1166872853 19:45881450-45881472 TGGCAGCTGATGCAGCCTGGGGG + Intergenic
1167533208 19:50031886-50031908 GGTCAGGGAAAGCTTCCTGGAGG - Intronic
1168317685 19:55491141-55491163 GGCCCGCTGCAGCTTCCTGGAGG - Intronic
1168713602 19:58514890-58514912 GGGCAACTGGGGCTTCCTGCAGG - Intronic
925191909 2:1892002-1892024 GGGCAGGTGGAGCCACCTGGCGG - Intronic
925484409 2:4312624-4312646 GGTCTGCTGGAGTTTCCTGGAGG + Intergenic
926314596 2:11700057-11700079 AGGCAGAGGAAGCTGCCTGGTGG + Intronic
926987348 2:18639317-18639339 GGGCAGCTGTGGTTTGCTGGGGG + Intergenic
927107399 2:19839989-19840011 GCGCAGGGGAGGCTTCCTGGAGG - Intergenic
930839162 2:55826237-55826259 GGGCAGCTGTAGCTTGCTGGAGG - Intergenic
931479046 2:62621655-62621677 GGTCTGCTGGAGCTTGCTGGGGG + Intergenic
931480491 2:62634151-62634173 GGTCTGCTGGAGCTTGCTGGAGG - Intergenic
931560527 2:63555728-63555750 GGGCTGCTGCAGCTTGCTGGGGG - Intronic
931569233 2:63650677-63650699 GGCAATCTGAAGTTTCCTGGAGG + Intronic
931797276 2:65723284-65723306 GAGAAGCTGAAGCTTCCAGTGGG - Intergenic
932599926 2:73116678-73116700 GGCAAGCTCAAGCTTCCTGCTGG + Intronic
933129593 2:78655695-78655717 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
933602432 2:84347308-84347330 GGGCTGCTGCAGTTTTCTGGGGG + Intergenic
934052954 2:88225509-88225531 GTGCAGGAGCAGCTTCCTGGAGG + Intergenic
935820453 2:106887520-106887542 GGGCAGCTGGAGCCTGCGGGCGG + Intergenic
936087451 2:109479000-109479022 CGGGAGCTGCAGCCTCCTGGAGG + Intronic
936473243 2:112817193-112817215 GGACACATGAAGGTTCCTGGAGG - Intergenic
936565652 2:113580725-113580747 GGGCTGCAGAGGCTTCCTAGAGG + Intergenic
936848989 2:116873476-116873498 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
936936871 2:117847426-117847448 AGTCAGGGGAAGCTTCCTGGAGG - Intergenic
937019109 2:118634009-118634031 GGCCAGCGGAGGCTGCCTGGAGG - Intergenic
937155714 2:119717437-119717459 GGGCAGGGCCAGCTTCCTGGGGG - Intergenic
937443008 2:121932904-121932926 TGGTAGCTGAAGCTACCTGGAGG + Intergenic
937893857 2:126962872-126962894 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
937931607 2:127209234-127209256 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
938949171 2:136241430-136241452 GGGCAGCAGGAGTTTCTTGGTGG + Intergenic
939109810 2:137992917-137992939 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
939116812 2:138070606-138070628 GGTCTGCTGAAGTTTTCTGGAGG + Intergenic
939365034 2:141219818-141219840 GGGCTGCTGGGGCTTACTGGGGG - Intronic
939391227 2:141571289-141571311 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
939398454 2:141661055-141661077 GGGCTGCTGCAGTTTGCTGGTGG - Intronic
939809069 2:146808746-146808768 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
939976090 2:148719487-148719509 GGGCTGCTGCAGTTTGCTGGAGG + Intronic
940124692 2:150310414-150310436 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
940638898 2:156328264-156328286 AGGCAGCTGCAGGGTCCTGGAGG + Intronic
940999118 2:160181862-160181884 GGTCTGCTGAAGTTTGCTGGAGG - Intronic
941694269 2:168534489-168534511 GGGCTGCTGCAGTTCCCTGGGGG + Intronic
942469557 2:176245447-176245469 GGGCTGCAGTAGCTTGCTGGGGG + Intergenic
942641925 2:178069675-178069697 CAGCAGCTGATGCTTCCTGTGGG - Intronic
943200474 2:184817283-184817305 GGGCTGCTGTAGTTTGCTGGGGG - Intronic
943240272 2:185376276-185376298 GGTCTGCTGCAGTTTCCTGGTGG + Intergenic
943286647 2:186009636-186009658 GGGCTGCTGAAGTTTGCTGGGGG - Intergenic
945112811 2:206378983-206379005 GGGCAGCTGAAGGGAGCTGGAGG + Intergenic
948315842 2:237027607-237027629 GGGCAGCTGAGTCCACCTGGTGG + Intergenic
948347076 2:237307690-237307712 GGGCAGCTGCTGCTGCCTGCTGG - Intergenic
1169051917 20:2586175-2586197 GTGCAGATGAAGCTCCATGGGGG + Intronic
1169277518 20:4243724-4243746 TGGCACCAGCAGCTTCCTGGGGG + Intronic
1169695670 20:8384790-8384812 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1169980693 20:11380397-11380419 GGGCTGCTGTAGTTTACTGGGGG - Intergenic
1170020425 20:11831196-11831218 GTGCTGCTGAAGTTTCATGGTGG + Intergenic
1170229288 20:14027679-14027701 GGTCAGCTGGAGTTTCTTGGAGG + Intronic
1170588801 20:17755487-17755509 AGGCAGGGGAAGCTTCCTGAAGG + Intergenic
1170727233 20:18941115-18941137 GGTCTGCTGGAGCTTGCTGGAGG + Intergenic
1171045899 20:21809281-21809303 CGGGAGCTGGGGCTTCCTGGGGG + Intergenic
1171491838 20:25525205-25525227 GGGCAGGTGAGGCTTCTTTGAGG + Intronic
1171504035 20:25618764-25618786 GAGCAGCTGGAGATTTCTGGGGG - Intronic
1172656982 20:36543418-36543440 AGGCAGAGGAGGCTTCCTGGAGG + Intronic
1172868027 20:38114703-38114725 GGGCAGTTGACGCTTGCTGTTGG - Intronic
1173864126 20:46303363-46303385 GGGCAGCAGAGGCTTCTAGGAGG - Intronic
1174953243 20:55066709-55066731 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1175606385 20:60315317-60315339 GGGCAGAGAAGGCTTCCTGGAGG + Intergenic
1175650250 20:60715511-60715533 GGGCAGCTGACCCGTTCTGGAGG + Intergenic
1176042710 20:63073699-63073721 GGGCAGCTGACCAGTCCTGGGGG - Intergenic
1176195123 20:63833159-63833181 GAGCAGCAGCAGCTGCCTGGCGG + Intergenic
1177117757 21:17105828-17105850 GGGCTGCTGAAGCTTGCTTGGGG - Intergenic
1178237299 21:30857682-30857704 GAACATCTGAAGCTTCCTGGAGG - Intergenic
1178858082 21:36266735-36266757 GGGGAGCTGAAGTTCTCTGGGGG + Intronic
1178923472 21:36756010-36756032 GGGCATCTTATGCCTCCTGGTGG - Intronic
1180468132 22:15635255-15635277 CGGGAGCTGCAGCTGCCTGGAGG + Intergenic
1180762464 22:18220622-18220644 GGGAACCTAAAGCTCCCTGGTGG - Intergenic
1180773203 22:18403986-18404008 GGGAACCTAAAGCTCCCTGGCGG + Intergenic
1180804558 22:18653535-18653557 GGGAACCTAAAGCTCCCTGGTGG + Intergenic
1180806192 22:18715875-18715897 GGGAACCTAAAGCTCCCTGGCGG - Intergenic
1180998409 22:19976795-19976817 GGGAACCTGAGGCTTCCGGGAGG - Intronic
1181217139 22:21341656-21341678 GGGAACCTAAAGCTCCCTGGTGG - Intergenic
1181235365 22:21445260-21445282 GGGCAGCTGGAGGTAGCTGGCGG - Exonic
1181557891 22:23682538-23682560 GGGCTGCAGAAGTGTCCTGGGGG + Intergenic
1181618233 22:24069933-24069955 GGGCAGCAGGTGCTTCCTGTAGG + Intronic
1182195024 22:28506796-28506818 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
1182421309 22:30249858-30249880 AGGCAGGGGAGGCTTCCTGGAGG - Intergenic
1182458529 22:30468452-30468474 GGGCAGGTGAGGCTGCCGGGGGG - Intronic
1182651237 22:31852919-31852941 AGGCAGCTGAAGCTGGATGGAGG + Intronic
1182732997 22:32510324-32510346 AGGCAGATGAAGCTTCATGTCGG - Intergenic
1183468084 22:37990164-37990186 GGGCAGGAGTGGCTTCCTGGAGG + Intronic
1183479083 22:38052991-38053013 GGCCAGCGAAGGCTTCCTGGAGG - Intergenic
1183491945 22:38121557-38121579 GGGCAGCTTCTCCTTCCTGGAGG - Intronic
1184088774 22:42281762-42281784 GGGCAGCTGTTCCATCCTGGTGG + Intronic
1184288709 22:43486754-43486776 GGGGAGGTGAGCCTTCCTGGGGG + Intronic
1184730514 22:46368835-46368857 GGGGAGATGAAACTTTCTGGTGG - Intronic
1184809619 22:46822506-46822528 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1203235035 22_KI270731v1_random:144968-144990 GGGAACCTAAAGCTCCCTGGTGG + Intergenic
949119828 3:372866-372888 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
949173775 3:1034391-1034413 GGTCAGCTGGAGTTTGCTGGAGG + Intergenic
949592805 3:5511084-5511106 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
949691769 3:6648669-6648691 GGGTAGGTGAAGCTTTCTAGTGG + Intergenic
950432886 3:12961171-12961193 GGGCAGGTCTGGCTTCCTGGTGG - Intronic
950486241 3:13275612-13275634 TGTCAGCAGAGGCTTCCTGGAGG - Intergenic
950566091 3:13770516-13770538 AGGGTGCTGCAGCTTCCTGGTGG + Intergenic
951350495 3:21601779-21601801 GATCAGCTCAAGCTTCCAGGGGG - Intronic
951686181 3:25347127-25347149 GGACAGCTAAACCTTGCTGGGGG - Intronic
951996492 3:28736027-28736049 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
952541970 3:34376334-34376356 TGGCAGCTGATGCTGGCTGGTGG - Intergenic
952903667 3:38126107-38126129 GGGCAGCTGCAGGATCCAGGTGG + Intronic
953805925 3:46067238-46067260 AGGCAGGTTAGGCTTCCTGGAGG + Intergenic
954577594 3:51685159-51685181 TGGCAGCCCAACCTTCCTGGAGG + Intronic
956005917 3:64777663-64777685 GGGCTGCTGGAGTTTGCTGGGGG - Intergenic
957011232 3:75008416-75008438 GGGAAGCTGGAGCTTGGTGGAGG - Intergenic
957098344 3:75799008-75799030 GGTCTGCTGAAGTTTGCTGGAGG + Intergenic
957200394 3:77127133-77127155 GAGCAGGTGGAGCTTCCTGTAGG - Intronic
957394834 3:79623050-79623072 GGGCTGCTGCAGATTCCTGGGGG - Intronic
957434033 3:80151563-80151585 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
957584240 3:82114140-82114162 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
958817248 3:98929219-98929241 GGTCTGCTGAAGTTTGCTGGGGG - Intergenic
958838411 3:99172783-99172805 GGGCAACTGCAGCTTGCTGGAGG - Intergenic
959025753 3:101237590-101237612 GGTCTGCTGGAGCTTGCTGGAGG - Intronic
959258805 3:104048802-104048824 GGGCTGCTGAAGTTTGCTGGGGG - Intergenic
959596395 3:108133598-108133620 GGGAGGCAGAAGCTTCCTGGAGG - Intergenic
960342123 3:116486739-116486761 GGGCAGCTGTGCTTTCCTGGGGG - Intronic
961175441 3:124831357-124831379 TGGCAGCTGAATCTTCCTACTGG + Intronic
961640914 3:128364367-128364389 GGCCAGAGCAAGCTTCCTGGAGG + Intronic
962024673 3:131535314-131535336 GGGCAGCTGGAGATGCCTGCAGG + Exonic
962064477 3:131964097-131964119 GGTCTGCTGAAGTTTGCTGGAGG - Intronic
962642266 3:137400090-137400112 GGTCTGCTGGAACTTCCTGGGGG + Intergenic
962986697 3:140542898-140542920 GACCAGCTGAGGTTTCCTGGTGG - Intronic
963531206 3:146475395-146475417 GGGCTGCTGCAGTTTTCTGGGGG + Intronic
963532111 3:146483663-146483685 GGGCTGCTGAAGTTTGCTAGGGG - Intronic
963633091 3:147758503-147758525 AGGCAGCGGAAGCATCCTGTAGG + Intergenic
964725946 3:159814587-159814609 GGCCAGCTACAGCTTTCTGGGGG - Intronic
965288712 3:166849234-166849256 GGGCTGCTGCAGTTTCCTGGAGG + Intergenic
965322674 3:167267892-167267914 GGGCAGCAGCAGCTGCCTGAGGG - Intronic
966539537 3:181074621-181074643 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
968097589 3:195942493-195942515 GTGCAGCTGAAGACTCCAGGAGG - Intergenic
968304425 3:197639887-197639909 GTGCAGCTGAAGACTCCGGGAGG - Intergenic
968549664 4:1215684-1215706 GGACAGATGCAGCTACCTGGGGG - Intronic
968692212 4:1998014-1998036 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
969014996 4:4098102-4098124 GGGCACCTCATGCTTCCTGAAGG + Intergenic
969798131 4:9541796-9541818 GGGCAGCCCATGCTTCCTGAAGG - Intergenic
970155202 4:13134201-13134223 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
970666402 4:18342468-18342490 GGGCTGCTGAAGTTTGCTGGGGG + Intergenic
971186545 4:24383100-24383122 GGTCTGCTGAAGTTTGCTGGAGG - Intergenic
971647777 4:29230495-29230517 GGTCTGCTGGAGTTTCCTGGAGG - Intergenic
972022040 4:34327228-34327250 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
972072489 4:35038685-35038707 GGGCAGCTGCAGCTGTATGGTGG - Intergenic
972590013 4:40476706-40476728 AGGGAGCTGAAGTTGCCTGGAGG + Intronic
972828241 4:42786273-42786295 GGGCAACTGCAGCTTGCTGGAGG + Intergenic
972990088 4:44814147-44814169 GGGCTGCTGCAGTTTACTGGGGG + Intergenic
973321910 4:48818295-48818317 GGTCTGCTGCAGCTTGCTGGAGG - Intronic
974271573 4:59656796-59656818 GGGCTGCTGCAGTTTGCTGGAGG - Intergenic
975106211 4:70571711-70571733 GGGCTGCTGCAGCATACTGGGGG + Intergenic
975358220 4:73433293-73433315 GGTCAGATAAGGCTTCCTGGAGG - Intronic
975479422 4:74860686-74860708 GGTCTGCTGAAGTTTGCTGGAGG - Intergenic
976807323 4:89063039-89063061 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
977002165 4:91518395-91518417 GGGCAACTGCAGCTTTCTGGAGG + Intronic
977046993 4:92079860-92079882 GGTCTGCTGAAGTTTGCTGGAGG - Intergenic
977607464 4:98996343-98996365 GGGGGGCTGAAGCTACCTGCCGG + Intronic
977657171 4:99535978-99536000 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
978206257 4:106083815-106083837 GGGCTGCTGCAGTTTCCTGGGGG - Intronic
978656932 4:111075421-111075443 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
978940321 4:114428915-114428937 GGGCTGCTGAAGTTTGCTGGGGG + Intergenic
979197744 4:117941062-117941084 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
979576204 4:122294499-122294521 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
979761713 4:124414232-124414254 GGGCAGCCAATGCTTACTGGAGG - Intergenic
980331342 4:131415119-131415141 GGGCAGCTGCAGTATGCTGGGGG - Intergenic
980744573 4:136998763-136998785 GGGCTGCTGCAGTTTTCTGGGGG + Intergenic
981629805 4:146805107-146805129 GGGCTGCTGGAGTTTGCTGGAGG - Intronic
981790845 4:148535368-148535390 GGGCTGCTGATGTTTGCTGGGGG + Intergenic
981846616 4:149176714-149176736 GGTCTGCTGAGGCTTGCTGGAGG - Intergenic
982391745 4:154872179-154872201 ATGCAGATGAAGCTTCCAGGTGG + Intergenic
982600558 4:157443705-157443727 GGGCAGCTGTGGCATTCTGGAGG + Intergenic
983299030 4:165902091-165902113 GGGATGCTCAAGCTTCGTGGGGG - Intronic
983547673 4:168979909-168979931 GGGCAGCTGCTGCATGCTGGAGG - Intronic
983774812 4:171594291-171594313 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
984215844 4:176911531-176911553 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
984465938 4:180100691-180100713 GGGCGGCTGAGGCTTGCTCGAGG + Intergenic
984626010 4:182008998-182009020 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
984723436 4:182998220-182998242 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
985206315 4:187541320-187541342 GGGTAGGTGAATCTTGCTGGTGG - Intergenic
985506383 5:283675-283697 GTGCAGCTGAAGCCTCAGGGAGG + Intronic
985741709 5:1621171-1621193 GTGCAGCTGAAGATTCAGGGAGG - Intergenic
985741738 5:1621405-1621427 GTGCAGCTGAAGACTCCGGGAGG - Intergenic
985897036 5:2754921-2754943 GGGCAGTTTCAGGTTCCTGGTGG + Intronic
986029550 5:3881850-3881872 GGGTAGCGGAGGCTTCCTGGGGG - Intergenic
986140753 5:5027089-5027111 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
987453963 5:18120081-18120103 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
987674853 5:21062084-21062106 GGGCTGCTGTAGTTTGCTGGCGG + Intergenic
987834607 5:23145701-23145723 GGGCTGCTGCAGTTTTCTGGGGG + Intergenic
988059594 5:26149429-26149451 GGGCTGCTGCAGTTTGCTGGTGG - Intergenic
989305538 5:39951085-39951107 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
990138992 5:52681948-52681970 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
990744304 5:58943032-58943054 GGGCAGCTCTAGCTCCCTGAGGG - Intergenic
991227717 5:64292379-64292401 GGGCTGCTGTGGCTTGCTGGGGG + Intronic
991610473 5:68444765-68444787 AGAAAGCTGAGGCTTCCTGGAGG + Intergenic
992038873 5:72808877-72808899 GGGATGCTCAAGCTTGCTGGGGG - Intergenic
992976797 5:82129611-82129633 GGACTGCTGGAGTTTCCTGGAGG + Intronic
993145152 5:84085443-84085465 GGTCAGCTGCAGTTTGCTGGAGG + Intronic
993253453 5:85556881-85556903 GGGCAGCTGCAGTTTGCTGGGGG - Intergenic
993280730 5:85921368-85921390 GGGCAACTGCAGCTTGCTGGAGG - Intergenic
993410376 5:87566784-87566806 GGTCAGCTGGAGTTTGCTGGGGG + Intergenic
993420934 5:87700456-87700478 GGGCTGCTGTAGTTTACTGGGGG + Intergenic
993808005 5:92436683-92436705 GGGCTGCTGAAGTTTGCTAGGGG - Intergenic
993922243 5:93819834-93819856 GGGCAGCTTAGGCTGCCTGGAGG + Intronic
994104632 5:95933185-95933207 AGGCAGCAGCAGCTTTCTGGGGG + Intronic
994298893 5:98122263-98122285 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
994843066 5:104951302-104951324 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
995003106 5:107158632-107158654 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
995052319 5:107720109-107720131 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
995464507 5:112436810-112436832 GGTCTGCTGGAGCTTGCTGGAGG - Intergenic
996030508 5:118699503-118699525 TTGCAGCTGAAGCATTCTGGAGG - Intergenic
996463126 5:123770312-123770334 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
996778527 5:127159348-127159370 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
996893934 5:128456672-128456694 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
997820972 5:137065338-137065360 GGGAAGCAGAAGCTACCTGTTGG - Intronic
1000222998 5:159232342-159232364 GAGCAGGGGCAGCTTCCTGGGGG + Intergenic
1000406579 5:160893916-160893938 GGTCTGCTGGAGCTTGCTGGAGG - Intergenic
1000719977 5:164693826-164693848 GGGCTGATGAAGCTTGCTGGAGG - Intergenic
1000995996 5:167959962-167959984 GGTCTGCTGAAGTTTGCTGGAGG + Intronic
1001097647 5:168788169-168788191 GGGCAGAGAAAGGTTCCTGGTGG + Intronic
1001108956 5:168879519-168879541 GAGGAGCTGATGCTTCATGGAGG - Intronic
1001173109 5:169440332-169440354 GGGGAAATAAAGCTTCCTGGTGG - Intergenic
1001489789 5:172147218-172147240 GACCAGGTGGAGCTTCCTGGAGG - Intronic
1001557011 5:172643449-172643471 GGTCAGGGAAAGCTTCCTGGAGG - Intronic
1001788924 5:174437666-174437688 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1002386949 5:178875478-178875500 TGGCAACTGCAGCTTCCTGGAGG + Intronic
1002509444 5:179703716-179703738 AGGAAGTTGAAGATTCCTGGGGG + Intronic
1002564450 5:180101907-180101929 GGGCTGCTGAGGCTCCCAGGAGG + Intronic
1002666629 5:180830348-180830370 AATCAGCAGAAGCTTCCTGGAGG - Intergenic
1002677264 5:180927196-180927218 GGTCTGCTGAAGTTTACTGGAGG - Intronic
1002709247 5:181184336-181184358 GAGCATCTGAAGGTTCCTAGAGG + Intergenic
1002813416 6:656630-656652 GGTCAGCTGCAGCTTCAGGGAGG + Exonic
1003686994 6:8314602-8314624 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1005095134 6:22106188-22106210 AGTCAGCTGAAACTTCATGGAGG - Intergenic
1005670386 6:28099597-28099619 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1005952953 6:30644913-30644935 GGAGAGCTGGAGGTTCCTGGAGG - Intronic
1006090510 6:31625903-31625925 GGGCAGGGGAAGCTTATTGGGGG + Intronic
1006447996 6:34090672-34090694 GTACAGCTGAAGCTGCTTGGGGG - Intronic
1006712260 6:36084080-36084102 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
1007195461 6:40056269-40056291 GGGCTGCTGTATTTTCCTGGGGG - Intergenic
1007416661 6:41694958-41694980 AGGCAGCTGGAGGGTCCTGGGGG - Intronic
1007942027 6:45790324-45790346 GGGAAACTGAAGCTTCACGGTGG - Intergenic
1007962011 6:45968432-45968454 GGGCAACAATAGCTTCCTGGGGG + Intronic
1008244152 6:49150247-49150269 GGGCTGCTGCAGTTTTCTGGGGG + Intergenic
1008468156 6:51854192-51854214 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1009240887 6:61184342-61184364 GGTCTGCTGGAGCTTGCTGGAGG - Intergenic
1009498171 6:64376268-64376290 GGACAACAGGAGCTTCCTGGGGG + Intronic
1010295755 6:74194225-74194247 GGGCTGCTGAAGTTTGCTGGGGG + Intergenic
1010483122 6:76378733-76378755 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1010872935 6:81064181-81064203 GGGCTCCTGAGGCTTCCTTGGGG + Intergenic
1011137691 6:84117731-84117753 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1011277005 6:85642133-85642155 GTGCTGCTGCAGCTTTCTGGGGG - Intronic
1013379826 6:109557255-109557277 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1013461621 6:110379454-110379476 GGGCTGCTGCAGGTTGCTGGGGG - Intergenic
1014369180 6:120583881-120583903 GGGCTGCTGTAGTTTGCTGGGGG + Intergenic
1015454971 6:133416149-133416171 GGGCAGATGAACCTTTATGGAGG + Intronic
1017754805 6:157520218-157520240 TGACAGCTAAATCTTCCTGGAGG - Intronic
1018578350 6:165283705-165283727 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
1019327240 7:444491-444513 TGGCAGGTGCAGCCTCCTGGTGG - Intergenic
1019346288 7:532334-532356 GGGCAGCTGGATCCTCCTGCAGG - Intergenic
1019389248 7:776532-776554 GGGCGGCTGGAGCTGCCTGTGGG + Intronic
1019540391 7:1548580-1548602 GGGCCGCAGGAGCTCCCTGGTGG + Exonic
1019719516 7:2559629-2559651 GGTCAGAGGAGGCTTCCTGGAGG + Intronic
1019999839 7:4749466-4749488 CGGCACCTGAAGCCTCCTGGGGG - Intronic
1020391307 7:7661573-7661595 GGTCTGCTGAAGTTTGCTGGAGG + Intronic
1020457725 7:8393478-8393500 GGGCAGCTGGAAGCTCCTGGTGG - Intergenic
1021782211 7:24117592-24117614 GGTCAGCTGGAGTTTGCTGGAGG + Intergenic
1022814531 7:33902136-33902158 GAGGAGATTAAGCTTCCTGGAGG - Intergenic
1024034288 7:45494712-45494734 GGGCTGCTGCAGTTTTCTGGGGG + Intergenic
1024290496 7:47800388-47800410 GGGCCAGGGAAGCTTCCTGGAGG + Intronic
1025014983 7:55432008-55432030 GGGCAGCTGGAGCTTTGTTGGGG + Exonic
1026657163 7:72266899-72266921 GGGCAGGTCAAGCCTCCAGGAGG + Intronic
1026992586 7:74595694-74595716 GGGCACCTGCAGGTTTCTGGAGG - Intronic
1027576138 7:79933632-79933654 GGGCTGCAGAAGTTTTCTGGGGG + Intergenic
1027582983 7:80020997-80021019 GGTCTGCTGGAGTTTCCTGGAGG - Intergenic
1028644252 7:93077245-93077267 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1028945502 7:96575233-96575255 GGTCTGCTGAAGTTTGCTGGAGG + Intronic
1029039590 7:97558400-97558422 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1030200888 7:106902311-106902333 GGTCAGCTGCAGCTTGCTGGAGG + Intronic
1030327920 7:108241069-108241091 GATCAGCTGATGTTTCCTGGAGG - Intronic
1030413527 7:109212625-109212647 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1030455419 7:109766844-109766866 GGGCTGCTGTGGCTTCCTTGGGG - Intergenic
1030487014 7:110182334-110182356 GGCCAGGTGAAGCTTTCTGAAGG + Intergenic
1030830132 7:114210400-114210422 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1031024038 7:116661373-116661395 GGGCAGCATAATCTTTCTGGAGG - Intergenic
1031039731 7:116826829-116826851 GGGCAACTGCAGCTTGCTGGAGG + Intronic
1031613668 7:123856462-123856484 GGTCTGCTGGAGTTTCCTGGAGG + Intronic
1031629634 7:124032130-124032152 CGGCAGCTGCAGTTTCGTGGTGG - Exonic
1032084983 7:128879190-128879212 TGTCAGCTGAAGTCTCCTGGGGG - Intronic
1032188217 7:129745895-129745917 GGGCATGAAAAGCTTCCTGGTGG + Intronic
1033045578 7:137959291-137959313 TGGCAGCTGAAGGTTCCAGGAGG - Intronic
1033839145 7:145352867-145352889 TGGCTGCTGAAGCTGCCTGCTGG - Intergenic
1034243160 7:149624791-149624813 AGGCACATGAGGCTTCCTGGAGG + Intergenic
1034955724 7:155333287-155333309 TTGCACCTGCAGCTTCCTGGGGG - Intergenic
1035209673 7:157318519-157318541 GCTCAGCTGAGGGTTCCTGGAGG + Intergenic
1035241277 7:157531264-157531286 GGAAAGCAGAAGCTTCCCGGAGG + Intergenic
1035534124 8:378271-378293 TGGCAGCAGAAGCTTCCTCTGGG - Intergenic
1035535121 8:385147-385169 TGGCAGCTGAAGCTACCTATTGG - Intergenic
1036566493 8:9942884-9942906 GGGCAGCAGGAGACTCCTGGAGG + Intergenic
1036568009 8:9954491-9954513 TGACAGATGAGGCTTCCTGGAGG - Intergenic
1037239466 8:16760599-16760621 GTGCAGCTGGAGCCTCCTTGAGG - Intergenic
1037664631 8:20957158-20957180 GGTCTGCTGGAGTTTCCTGGAGG - Intergenic
1038011559 8:23480440-23480462 GTGGAGATGAAGCTTCCTGCTGG + Intergenic
1038898345 8:31812938-31812960 GGACCACTGAAGCTACCTGGTGG + Intronic
1039637020 8:39178787-39178809 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1039685824 8:39801279-39801301 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1039869479 8:41533441-41533463 GCACAGCTGCAGCTTGCTGGTGG + Intronic
1040614091 8:49017811-49017833 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1040841928 8:51793202-51793224 GGGCTGCTGTGGTTTCCTGGGGG - Intronic
1041747500 8:61224435-61224457 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1041986833 8:63931548-63931570 GGGCATGTGAAGATTCCTTGAGG - Intergenic
1042630054 8:70806141-70806163 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1042683655 8:71414063-71414085 GGGCAGCTGAAGCTTCCTGGAGG - Intronic
1043191135 8:77224814-77224836 GGGCTGCTGCAGCATGCTGGGGG + Intergenic
1044135792 8:88584307-88584329 GGGCTGCTGCAGTTTTCTGGGGG + Intergenic
1044540629 8:93404887-93404909 GGGCAGCTGCAGCTTTAGGGGGG + Intergenic
1044595253 8:93953117-93953139 GGGAAGCTGGAGCTTGGTGGGGG - Intergenic
1044872423 8:96632423-96632445 GGGCAGAGAAAGTTTCCTGGAGG - Intergenic
1044899939 8:96933641-96933663 GGTCAGCAAAAGCTTCCTGGGGG + Intronic
1045205695 8:100037661-100037683 GGGCAGCTGAAGATTTTTGGAGG + Intronic
1045349145 8:101322495-101322517 GGGCATCTGACACTTCCTTGGGG - Intergenic
1045939893 8:107727284-107727306 GAGCAGTTGAATGTTCCTGGAGG + Intergenic
1046255680 8:111693983-111694005 GGGCAACTGCAACTTGCTGGAGG + Intergenic
1046338801 8:112825595-112825617 AGGCTGCTGCAGTTTCCTGGAGG + Intronic
1046416241 8:113917227-113917249 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1046487911 8:114910099-114910121 GGGCAGATGCAGCATGCTGGAGG - Intergenic
1046660327 8:116941483-116941505 AGAGAGCTGAAGCTTCCTGCAGG + Intronic
1046782664 8:118232270-118232292 GGGCATCTAAATCATCCTGGGGG + Intronic
1047000677 8:120569579-120569601 GGACAGCTGAGGCTGCCTGGAGG - Intronic
1047152013 8:122274248-122274270 GGGCTGCTGAAGTTTGCTGGGGG - Intergenic
1048255303 8:132901004-132901026 GGCCAGCAGAGGCTTCCTGGAGG - Intronic
1049003045 8:139838229-139838251 GGGCAGGGGAAGCCTCCTGGAGG - Intronic
1049209086 8:141377081-141377103 GAGCAGGTGGGGCTTCCTGGAGG + Intergenic
1049212621 8:141393669-141393691 GGTCAGCGCAAGCTTCCGGGAGG - Intronic
1049455040 8:142682439-142682461 GGGCAGGGAAGGCTTCCTGGGGG - Exonic
1049582976 8:143421116-143421138 GGGCAGGCGAGGCCTCCTGGAGG + Intronic
1049791966 8:144476259-144476281 GATCAGGTGGAGCTTCCTGGAGG + Exonic
1049804927 8:144534430-144534452 GGGCAGGTGGAGCTGCCAGGCGG - Intronic
1049886767 9:32498-32520 GGGCTGCAGAGGCTTCCTAGAGG - Intergenic
1051603555 9:18897603-18897625 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
1052025192 9:23566180-23566202 GGGAAGTTGAGGCTTCCAGGGGG + Intergenic
1052325089 9:27209029-27209051 GGGTAGCTGAAGGTTCTTAGGGG + Intronic
1052420891 9:28241849-28241871 GGGCTGCTGCAGTTTGCTGGGGG - Intronic
1052628423 9:31005608-31005630 GGTCTGCTGCAGTTTCCTGGAGG - Intergenic
1052959125 9:34279580-34279602 GGGAAGGAGAAACTTCCTGGAGG + Intronic
1053607892 9:39679388-39679410 GGACAGCTGCAGCATGCTGGAGG - Intergenic
1053865735 9:42435748-42435770 TGGCAGCTGCAGCATGCTGGAGG - Intergenic
1054245642 9:62663021-62663043 GGACAGCTGCAGCATGCTGGAGG + Intergenic
1054559769 9:66697552-66697574 GGACAGCTGCAGCATGCTGGAGG + Intergenic
1056336816 9:85579030-85579052 GAGCAGCTGTAGCTTCGTAGTGG - Exonic
1056601216 9:88048565-88048587 GGGGAGCTGAAGCCACATGGTGG + Intergenic
1056733712 9:89186363-89186385 GGGGAGTTGAAGCTGCTTGGAGG - Intergenic
1056920813 9:90787216-90787238 GGGCAGATGCAGCTCCCTGCTGG + Intergenic
1057017045 9:91661557-91661579 GGGCAGCAGGAACTTCCAGGAGG + Intronic
1057231252 9:93322877-93322899 GGGCAGATGAAGCTTCCAGTGGG + Intronic
1057241565 9:93416421-93416443 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1057423304 9:94928968-94928990 GAGCAGCAGAGGCTTCCTGCTGG - Intronic
1057809457 9:98246676-98246698 GGTCAGGGGAAACTTCCTGGAGG + Intronic
1059224628 9:112660125-112660147 GAGCAGCTGGAGCTCCTTGGAGG + Exonic
1059260723 9:112973719-112973741 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1059346531 9:113632661-113632683 GGGCAGAGGAAGGTTCTTGGAGG + Intergenic
1061402410 9:130375710-130375732 GAGCAGCTGGATGTTCCTGGAGG - Intronic
1061800129 9:133109132-133109154 GGGCATCTGCAGGTCCCTGGCGG + Intronic
1062087421 9:134656019-134656041 GGGCAGGTCCAGCTTCCTGCAGG + Intronic
1062318188 9:135978347-135978369 GGGCTGCTGAAGGTTCTGGGGGG - Intergenic
1062541063 9:137041760-137041782 GAGCAGCAGCGGCTTCCTGGAGG - Intronic
1062633256 9:137476960-137476982 GGCCAGCAGAAGCATCCTCGAGG + Intronic
1185644891 X:1609519-1609541 AGGCACCTGAAGCTTCCTACAGG - Intergenic
1185737942 X:2507314-2507336 GGGCAGGAGATGCTCCCTGGAGG + Intergenic
1185846178 X:3440482-3440504 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1186431038 X:9504170-9504192 GGGCTGCTGCAGTTTGCTGGTGG - Intronic
1186960850 X:14735501-14735523 GGTCTGCTGGAGTTTCCTGGAGG + Intergenic
1187511625 X:19924873-19924895 GAGCAGAGGATGCTTCCTGGGGG + Intronic
1188099824 X:26070785-26070807 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1188717401 X:33476866-33476888 GGACAGCTGCAGCATGCTGGAGG - Intergenic
1188744746 X:33829046-33829068 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1188884437 X:35531941-35531963 GGGCTGCTGAGGTTTGCTGGGGG - Intergenic
1189230419 X:39448050-39448072 GGGCAGCTCAAAGTGCCTGGGGG - Intergenic
1189855069 X:45215333-45215355 GGGCTGCTGTAGTTTGCTGGGGG - Intergenic
1191097337 X:56687865-56687887 GGTCTGCTGAAGTTTGCTGGAGG + Intergenic
1191225091 X:58034618-58034640 GGGCTGCTGTAGTTTTCTGGGGG + Intergenic
1191848495 X:65568585-65568607 GGTCTGCTGGAGTTTCCTGGAGG + Intergenic
1192245919 X:69371459-69371481 GGCCAAGGGAAGCTTCCTGGTGG + Intergenic
1192718535 X:73668602-73668624 GGGCTGCTGCAGTTTGCTGGGGG + Intronic
1192756278 X:74049644-74049666 TGGCAGCTGCAGCATACTGGAGG - Intergenic
1193005932 X:76618110-76618132 GGGCTGCTGCAGCATGCTGGGGG - Intergenic
1193043746 X:77031304-77031326 GGTCAGCTGGAGTTTGCTGGAGG + Intergenic
1193060056 X:77196723-77196745 GGTCTGCTGGAGTTTCCTGGAGG + Intergenic
1193295727 X:79829500-79829522 GGTCAACTGAAGCTTATTGGAGG + Intergenic
1193687259 X:84592335-84592357 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1193714899 X:84926742-84926764 GGTCAGCTGTAGCTTCTTGGAGG + Intergenic
1193719409 X:84970922-84970944 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1194193618 X:90865853-90865875 GGGCTGCTGCAGTTTTCTGGGGG - Intergenic
1194366361 X:93018935-93018957 GGGCAGCTGTGGCTTGCTGGAGG - Intergenic
1194444871 X:93975430-93975452 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1194596809 X:95868494-95868516 GGGCTGCTGAAGTTTGCTGTGGG - Intergenic
1194837371 X:98698377-98698399 GGTCTGCTGAAGTTTGCTGGAGG + Intergenic
1194899995 X:99498096-99498118 GGGCAACTGCAGCTTGCTAGAGG - Intergenic
1195102401 X:101567730-101567752 GGTCTGCTGAAGTTTGCTGGAGG - Intergenic
1195147264 X:102029905-102029927 GGGCTGCTGAGGTTTACTGGGGG - Intergenic
1195473484 X:105259676-105259698 GGTCAACTGCAGCTTGCTGGTGG + Intronic
1195979256 X:110560678-110560700 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1197403833 X:126026994-126027016 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1197602044 X:128542892-128542914 GGGCTGCTGCAGTTTGCTGGGGG + Intergenic
1197706489 X:129638193-129638215 GGTCAGAGAAAGCTTCCTGGAGG - Intergenic
1199079598 X:143561764-143561786 GGGCTGCTGAGGTTTGCTGGTGG - Intergenic
1199589184 X:149450795-149450817 GGGCTGCTGTAGTTTGCTGGGGG + Intergenic
1200154672 X:153969192-153969214 GGGAAGCTGGAGCTGCCTGGAGG - Intronic
1200365308 X:155656866-155656888 GGTCTGCTGCAGTTTCCTGGAGG + Intronic
1200540230 Y:4448235-4448257 GGGCTGCTGCAGTTTTCTGGGGG - Intergenic
1200674588 Y:6135197-6135219 GGGCAGCTGTGGCTTGCTGGAGG - Intergenic
1200732488 Y:6757913-6757935 GGTCTGCTGGAGTTTCCTGGAGG + Intergenic
1200818327 Y:7555920-7555942 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1201018382 Y:9626571-9626593 GGGCACCTGAAGCCTCCTAAGGG + Intergenic
1201936045 Y:19411922-19411944 GGGCTGCTGCAGTTTGCTGGGGG - Intergenic
1202030226 Y:20563814-20563836 GGGCTGCTGAAGTTTGCTAGAGG - Intergenic