ID: 1042683655

View in Genome Browser
Species Human (GRCh38)
Location 8:71414063-71414085
Sequence GGGCAGCTGAAGCTTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683655_1042683668 26 Left 1042683655 8:71414063-71414085 CCTCCAGGAAGCTTCAGCTGCCC No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683655_1042683665 12 Left 1042683655 8:71414063-71414085 CCTCCAGGAAGCTTCAGCTGCCC No data
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
1042683655_1042683666 21 Left 1042683655 8:71414063-71414085 CCTCCAGGAAGCTTCAGCTGCCC No data
Right 1042683666 8:71414107-71414129 TTATCCTGAGTAGGAGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683655 Original CRISPR GGGCAGCTGAAGCTTCCTGG AGG (reversed) Intronic