ID: 1042683656

View in Genome Browser
Species Human (GRCh38)
Location 8:71414066-71414088
Sequence CTGGGGCAGCTGAAGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683656_1042683665 9 Left 1042683656 8:71414066-71414088 CCAGGAAGCTTCAGCTGCCCCAG No data
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
1042683656_1042683666 18 Left 1042683656 8:71414066-71414088 CCAGGAAGCTTCAGCTGCCCCAG No data
Right 1042683666 8:71414107-71414129 TTATCCTGAGTAGGAGCTACAGG No data
1042683656_1042683668 23 Left 1042683656 8:71414066-71414088 CCAGGAAGCTTCAGCTGCCCCAG No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683656 Original CRISPR CTGGGGCAGCTGAAGCTTCC TGG (reversed) Intronic