ID: 1042683656

View in Genome Browser
Species Human (GRCh38)
Location 8:71414066-71414088
Sequence CTGGGGCAGCTGAAGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683656_1042683665 9 Left 1042683656 8:71414066-71414088 CCAGGAAGCTTCAGCTGCCCCAG 0: 1
1: 0
2: 4
3: 35
4: 341
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
1042683656_1042683666 18 Left 1042683656 8:71414066-71414088 CCAGGAAGCTTCAGCTGCCCCAG 0: 1
1: 0
2: 4
3: 35
4: 341
Right 1042683666 8:71414107-71414129 TTATCCTGAGTAGGAGCTACAGG No data
1042683656_1042683668 23 Left 1042683656 8:71414066-71414088 CCAGGAAGCTTCAGCTGCCCCAG 0: 1
1: 0
2: 4
3: 35
4: 341
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683656 Original CRISPR CTGGGGCAGCTGAAGCTTCC TGG (reversed) Intronic
900310195 1:2029810-2029832 CTGGGGCAGCTGAAGGGTCCTGG - Intronic
900389727 1:2428733-2428755 CTGGATCAGCTCAAGCCTCCAGG + Intronic
900567538 1:3340989-3341011 GTGTGGCAGCTGAAGGCTCCAGG + Intronic
900609787 1:3539644-3539666 CTGGGGCCACTGGGGCTTCCGGG + Intronic
901857321 1:12052739-12052761 CAGGGGCAACTGAAGCATCCAGG - Intergenic
902183403 1:14707009-14707031 CTGTGGCCTCTGAAGTTTCCGGG - Intronic
902777805 1:18685760-18685782 CTGGCGTGGCTGAGGCTTCCTGG + Intronic
904033240 1:27546112-27546134 CTGCTGCCACTGAAGCTTCCTGG - Intronic
905473893 1:38212443-38212465 CTGAGGCAGCTGGGGTTTCCAGG + Intergenic
905772062 1:40644796-40644818 CTGGGGCAGCTGACCATGCCAGG + Intronic
905851720 1:41279713-41279735 CTGGGGCCCCTGAAGCTCTCAGG + Intergenic
906163233 1:43666702-43666724 GTGGGGCCACTGTAGCTTCCTGG + Intronic
907442299 1:54486706-54486728 GTGGGGGACCTGAAGCTTTCTGG - Intergenic
907726475 1:57025111-57025133 CTGCACCAGCTGAAGCTGCCGGG - Intronic
907912763 1:58841354-58841376 TTGGGGCAGCTGCATCTACCTGG + Intergenic
910191966 1:84604159-84604181 CTGGGGCAACTGAGGATTTCTGG + Intergenic
910483338 1:87682750-87682772 CTGTGCCAGCTGAAGCTTCTGGG - Intergenic
911161313 1:94685378-94685400 CTTGCACAGCTGAGGCTTCCTGG - Intergenic
914244125 1:145873167-145873189 CTGAGGCAGCAGCAGCTGCCTGG - Exonic
915403980 1:155645119-155645141 CTAGGGCAACTAAAGGTTCCTGG - Intergenic
915527163 1:156483025-156483047 CTGTGGCAGCAGAAGAGTCCTGG + Intronic
918536930 1:185584944-185584966 CCGGGGCACCACAAGCTTCCCGG + Intergenic
919824745 1:201495499-201495521 CTGGGCCAGGTGATGTTTCCAGG - Intronic
921217538 1:212950628-212950650 CTGGGGCTGCTGGGGCTTGCTGG - Exonic
922723954 1:227914051-227914073 CTGGGGCAGGTTCTGCTTCCAGG - Intergenic
923215533 1:231845024-231845046 CTCATGCAGCTGAAGCCTCCAGG + Intronic
924710875 1:246529148-246529170 CAGGGGCAACTGAGGGTTCCTGG + Intergenic
1062909653 10:1204551-1204573 GTGGGGCAGCTGTGGCCTCCTGG - Intronic
1063150494 10:3332233-3332255 TTGGCGTAGCTGTAGCTTCCAGG - Intergenic
1063151077 10:3336867-3336889 CTGGGGCTGCTACTGCTTCCGGG - Intergenic
1065694181 10:28364549-28364571 CTGGGGAGGCTGAAGCTACTGGG + Intergenic
1066291395 10:34017444-34017466 CTGGGGCACCTGAGGCTTGGAGG + Intergenic
1067980884 10:51083115-51083137 ATTGGGGAGCTGAAGCTGCCTGG - Intronic
1069292837 10:66804322-66804344 CTGGGGCAGCTGGAGAGACCAGG - Intronic
1069854825 10:71434321-71434343 CTGGGGGAGCTGAGACTGCCTGG - Intronic
1069894119 10:71670077-71670099 CAGGAGCAGCTGAAGATGCCCGG - Intronic
1070859464 10:79638872-79638894 TTGGTGGAGCTGGAGCTTCCTGG - Intergenic
1072201218 10:93160801-93160823 CTTTGGCAGTTGGAGCTTCCTGG + Intergenic
1073847658 10:107576991-107577013 GTGAGGAAGCTGAAGCTTACAGG - Intergenic
1073948777 10:108783615-108783637 CTGGGGCAACTGAGGATTTCTGG + Intergenic
1074358210 10:112804296-112804318 CTTGGGAAGCAGCAGCTTCCTGG + Intronic
1075602563 10:123781166-123781188 CTGTGGGAGCTGAAGCACCCTGG + Intronic
1075630153 10:123995723-123995745 CTGGGGCGGCTCGAGGTTCCTGG + Intergenic
1075734332 10:124654757-124654779 CTGGGGGAGCAGAAGGTCCCAGG - Intronic
1075921935 10:126220859-126220881 CTGGGGCACCTGTGGGTTCCTGG + Intronic
1076244708 10:128937711-128937733 CAGGGCCAGCTGTGGCTTCCTGG - Intergenic
1076693898 10:132237785-132237807 GTGGGGAAGCTGATTCTTCCAGG - Intronic
1076802743 10:132838843-132838865 TGGGGGCAGCTGAGGCTCCCTGG - Intronic
1076812700 10:132897600-132897622 GTGGGCCAGATGCAGCTTCCTGG - Intronic
1076992172 11:281127-281149 CTGGAGCAACTGGAGCTTCGTGG + Exonic
1077030315 11:462559-462581 CTGGGGCAGCCGAGCCTTCCAGG - Intronic
1077088148 11:765048-765070 CTGGGGCAGGTGATGCTTAGGGG - Intergenic
1077118249 11:895159-895181 CTGGGGAAGCTGACCCTACCTGG + Intronic
1077257038 11:1590281-1590303 CTGTGGAAGCTGGAGCTGCCTGG + Intergenic
1080187918 11:29512906-29512928 CTGGGGAAAATGGAGCTTCCAGG - Intergenic
1080723331 11:34870655-34870677 CTGGGGCAGCTGAGGCTCTCAGG - Intronic
1081831548 11:46120164-46120186 CTGCGGCTGCTGACGCTGCCGGG - Intronic
1084022123 11:66423998-66424020 CTGGGGAAGCTGGTGCTTCTGGG - Exonic
1084274656 11:68045131-68045153 GTGGGGCAGCTGAGCCTCCCAGG - Intronic
1084799828 11:71536011-71536033 CTGGGGCAGCGGACGCTCTCAGG + Intronic
1084986123 11:72873794-72873816 CTGAGGCAGCTCCAGCATCCCGG + Intronic
1085332880 11:75667968-75667990 CTCGGGCCGCTGCACCTTCCAGG + Exonic
1086203860 11:84235009-84235031 ATTAGGCAGGTGAAGCTTCCAGG - Intronic
1088594191 11:111427734-111427756 TTGGGGTAGCTGCAGCTTCTGGG - Intronic
1088817289 11:113430253-113430275 CTGGGAGAGCTGTATCTTCCAGG - Intronic
1089130707 11:116209746-116209768 CTGTAGCAGCTGTGGCTTCCCGG + Intergenic
1089505924 11:118961750-118961772 TTTGGGCAGCTGTAGCCTCCTGG + Intergenic
1089649242 11:119901666-119901688 CTTAGGCAGGTGCAGCTTCCAGG + Intergenic
1090649410 11:128793330-128793352 GTGGGGCAGCTGGAGCATCCTGG - Intronic
1090923059 11:131224154-131224176 CAGGGGCAGCTGAAGCTGGGAGG + Intergenic
1091265660 11:134269377-134269399 CTGATGAAGCTGAAGCTTCTGGG - Intergenic
1091896581 12:4109998-4110020 ATGGGGAAGATGAAGCTTTCTGG - Intergenic
1094107994 12:26833369-26833391 CGGCGGCAGCAGAGGCTTCCCGG - Intergenic
1096120740 12:49088148-49088170 GTAGGGCATCTGCAGCTTCCAGG + Intergenic
1096145582 12:49276602-49276624 CTGAGGCCGCTGAAGCTTGATGG + Intergenic
1096352921 12:50915378-50915400 CTGGGGCAACTGAGGGTTTCTGG + Intergenic
1097010956 12:55953203-55953225 CTGGGGCAGCAGAAGGGTCATGG + Intronic
1097270468 12:57771035-57771057 CTGAGGCAGCAGAAGCTACTAGG + Intronic
1098166531 12:67704272-67704294 AAGGGGCAGCTGGAGCTTCAAGG - Intergenic
1100596053 12:96073092-96073114 CTGGGACAGTTGGAGCTGCCAGG - Intergenic
1101442143 12:104711867-104711889 CTGAGGCAGAAGAAGCTTCCGGG + Intronic
1101584788 12:106076222-106076244 GTGAAGCAGCTGAAGGTTCCAGG + Intronic
1102426102 12:112845514-112845536 CTGGTGAAGATGAAGCTTCAGGG - Intronic
1102899407 12:116624748-116624770 CTGGAGCAGCTGGAGGGTCCAGG + Intergenic
1103937798 12:124485767-124485789 ATGGGGCAGCTGAGGCTGCGAGG - Intronic
1104910338 12:132237216-132237238 CTGGGGCAGCTGAGGGTACACGG - Intronic
1105424586 13:20283626-20283648 CTGGGGCAACTGAAGGTATCTGG + Intergenic
1105835658 13:24209030-24209052 CAGGGTCAGCTGTGGCTTCCTGG + Intronic
1108191958 13:47950781-47950803 CTGGGGCAGCAGGAGCCTCAGGG + Intronic
1109308365 13:60664108-60664130 CTAGGGCAGCTGCAGCCTCCTGG - Intergenic
1109534290 13:63695585-63695607 CAGGGCCAGCTGAACCTCCCCGG - Intergenic
1111631094 13:90847092-90847114 CTGGGGCAGCTGCAACTTCAGGG - Intergenic
1111859605 13:93685241-93685263 CTGGAACAGCCAAAGCTTCCTGG - Intronic
1112200427 13:97268993-97269015 GTGGCTCAGCTGAACCTTCCTGG + Intronic
1112492580 13:99880735-99880757 CTGGGGCAGCTCCACCTGCCAGG - Intronic
1112823802 13:103367783-103367805 ATGGGGCCTCTGAAGCTGCCTGG - Intergenic
1113269505 13:108657026-108657048 CTGCTGCAGCTGAAGCTTCCAGG + Intronic
1113816628 13:113176086-113176108 CTGGGGCAGCTCCTGCATCCAGG + Intergenic
1113917291 13:113882043-113882065 CTGGGGAAGCTCAGGGTTCCTGG + Intergenic
1113936151 13:113996167-113996189 CTGGGCCAGACGAAGCTTTCAGG + Intronic
1114487627 14:23072352-23072374 CTTGGGTAGCTGAAGCTTGAAGG + Intronic
1117992941 14:61452518-61452540 CTGAGGCACCGGAAGCTGCCTGG - Intronic
1119806320 14:77484720-77484742 CTGGAGCTGCAGAAGCTGCCGGG - Exonic
1120055720 14:79921672-79921694 CTGGGGAAGCAGAAGCTTAGGGG + Intergenic
1120951365 14:90045014-90045036 CAGGGGCAGCATAGGCTTCCAGG + Intergenic
1121457314 14:94046711-94046733 ATGGGACAGCTGCGGCTTCCTGG - Exonic
1122396900 14:101440061-101440083 CTGGAGCCGCTGAAGCCTGCAGG - Intergenic
1122982777 14:105199084-105199106 CTGTGTGAGCAGAAGCTTCCTGG + Intergenic
1123769149 15:23511294-23511316 CTGGGGCAACTGAAATTTTCTGG - Intergenic
1124620828 15:31272932-31272954 CTGGAGCAGATGGAGCTCCCAGG - Intergenic
1124672372 15:31652847-31652869 GTGGGGCAGCTGGAGCTCTCAGG + Intronic
1126091656 15:45058249-45058271 CTGGGACAACTGAAGGTTTCTGG - Intronic
1128719309 15:69934681-69934703 CTGGCACAGCTGAAGCATCTAGG + Intergenic
1129228704 15:74184646-74184668 CTGGGGAAGCTGCACCTGCCCGG - Intronic
1129299815 15:74619119-74619141 ATGGGGCTGCTGGGGCTTCCCGG - Intronic
1129661343 15:77554687-77554709 CTGGTGGAGGTGGAGCTTCCTGG + Intergenic
1129755328 15:78094594-78094616 CTGGGGGAGCTGCAGGTTGCTGG + Intronic
1131053961 15:89364860-89364882 CAGGGGCACCTGCAGCTACCAGG - Intergenic
1132031827 15:98444812-98444834 CTGGGGCAGCGGACACCTCCAGG - Intronic
1132299347 15:100766725-100766747 CTGGAGCTGCTGCAGCTCCCAGG - Intergenic
1132541919 16:514159-514181 CTGGGCCTCCTGCAGCTTCCTGG + Intronic
1132754265 16:1474998-1475020 CGGGGGCAGCCGGCGCTTCCCGG - Exonic
1133423323 16:5665734-5665756 CTGGGGCAGCTGAGTTTTCCAGG - Intergenic
1134426716 16:14155938-14155960 CTAAGGCAGCTGAAGTTTCAGGG - Intronic
1134893852 16:17866173-17866195 CTGGGTCCCCTGAAGTTTCCAGG - Intergenic
1136287538 16:29253301-29253323 CTCTGGCAGCTGGACCTTCCTGG + Intergenic
1136365080 16:29806159-29806181 CTGGAGCAGCTTCATCTTCCAGG + Intronic
1137370841 16:47904358-47904380 CTGGGGCCTCAGAATCTTCCAGG - Intergenic
1137395841 16:48115668-48115690 CTTGGGCAATGGAAGCTTCCTGG + Intronic
1137539419 16:49351815-49351837 CTGGGGAAGATGAGGCTCCCAGG + Intergenic
1139965961 16:70745559-70745581 CAGGGGCTGCTGAGGCTTCCTGG + Intronic
1140699631 16:77569517-77569539 TTGGGACAGCTGAGGCTACCAGG - Intergenic
1140809453 16:78563346-78563368 CTGGAGCAGCTGCAGATTCAGGG + Intronic
1141502206 16:84451947-84451969 CTGGGGCGGCTGACGTTTCTCGG + Exonic
1142093160 16:88225930-88225952 CTCTGGCAGCTGGACCTTCCTGG + Intergenic
1142247565 16:88976907-88976929 CTGGGCCAGCTGGGGCGTCCTGG + Exonic
1142442305 16:90106660-90106682 CTGGGGAAGCTGTGGCTTCATGG + Intergenic
1142978875 17:3660168-3660190 CTGAGGCAGCTGGAGCTTGTGGG - Intronic
1143117793 17:4590537-4590559 CTGGGGCACCTGGAGCATCAGGG - Intronic
1143462795 17:7114696-7114718 CTGGGGCAGGTGGAGCTCACAGG + Intronic
1144465742 17:15495738-15495760 CTGAGGCAGCTGCAGCATCTTGG + Intronic
1144570771 17:16397276-16397298 ATCAGGCAGATGAAGCTTCCAGG - Intergenic
1145362907 17:22227050-22227072 ATCAGGCAGATGAAGCTTCCAGG - Intergenic
1146929666 17:36768365-36768387 CTGTGGGAGGTGCAGCTTCCTGG + Intergenic
1146948240 17:36888686-36888708 CTGGGGCAGCTGAAGCTGGGAGG - Intergenic
1147132121 17:38415680-38415702 CTGGTGCAGCTGAGGCTGCAGGG - Intergenic
1147267566 17:39244169-39244191 CTGTGGTTGTTGAAGCTTCCAGG + Intergenic
1148160215 17:45445521-45445543 CGGGAGCAGCTGAAGCTCCTGGG - Exonic
1149994880 17:61401104-61401126 CTGGGGCGGCGGATGCGTCCAGG - Intronic
1150391506 17:64792400-64792422 CGGGAGCAGCTGAAGCTCCTGGG - Intergenic
1150450331 17:65261290-65261312 CTGAGGCAGCTGCAGCTAACAGG - Intergenic
1151089738 17:71424066-71424088 CTGGGGCAGGTGCAACTTGCAGG + Intergenic
1151554656 17:74840634-74840656 CTGTGGCAGGTGAGGCATCCTGG - Intergenic
1152123204 17:78431467-78431489 CTGGGGGAGCTGTAGCTCTCAGG + Intronic
1152303329 17:79507853-79507875 CTGGGGAAGCTGAGCCTTCCTGG + Intronic
1152565791 17:81099744-81099766 CCGGGGTAGCTGAAGCCTCCTGG + Intronic
1152865006 17:82717067-82717089 CGGGGGCGGCGGAAGCGTCCGGG + Intronic
1152900764 17:82939787-82939809 CTGGGGCAGCAGCACCTGCCAGG - Intronic
1157661315 18:49447594-49447616 CTGGGGCAACTGAGGATTTCTGG + Intronic
1158850943 18:61495597-61495619 CTGGGGCCGCAGGAGCTTCGAGG - Intronic
1159438698 18:68449823-68449845 CTGGGGAAGGTGAAGTTTCATGG + Intergenic
1159950586 18:74479842-74479864 CTAGGGCAGCTGAGGGTTACTGG - Intergenic
1160430219 18:78805843-78805865 CTGGGGCATCTGAGGCCTTCTGG - Intergenic
1160787729 19:909066-909088 CGGGGGTATCTGAGGCTTCCTGG + Intronic
1161070955 19:2260719-2260741 CTGGGAAAGCTGAGCCTTCCAGG - Intronic
1161534646 19:4811627-4811649 CTGGGACAAGTGAAGGTTCCTGG + Intergenic
1161573175 19:5041330-5041352 CCTTGGCAGATGAAGCTTCCAGG + Intronic
1162066511 19:8129072-8129094 CAGGAGCAGCTGTAGCTGCCAGG + Exonic
1163304831 19:16471630-16471652 CTGCCGCCGCTGAAGCTCCCAGG - Intronic
1163713541 19:18861095-18861117 GTGGGCCAGCTGGTGCTTCCTGG - Intronic
1164109587 19:22143441-22143463 CTAGGGCTACTGAAGGTTCCTGG + Intergenic
1164194555 19:22944638-22944660 CTAGGGCAACTGAAGGTTCCTGG + Intergenic
1165890647 19:39110268-39110290 CTGGGGCAGCTGTTCCCTCCTGG + Exonic
1166054213 19:40279024-40279046 CTGGGGCAGTTGCCGCTCCCCGG - Intronic
1166357604 19:42236362-42236384 CTGGGGTTGCAGAAGCTGCCAGG - Intronic
1168077630 19:53990148-53990170 CTGGGGGAGCTGAAACTGCATGG + Exonic
1168279342 19:55296119-55296141 TGGGGGCAGGGGAAGCTTCCTGG - Intronic
1168569887 19:57457840-57457862 CTCGGGAGGCTGAAGCCTCCTGG + Intronic
925153921 2:1635969-1635991 CAGGGGTAGCAGAAGCCTCCTGG + Intronic
925266060 2:2567129-2567151 CTGGAGGAGCTGAGGCTTCGAGG - Intergenic
926305426 2:11634418-11634440 CTGGGGCTGCAGAGGCGTCCTGG + Intronic
927110251 2:19859354-19859376 CTGGAGGAGCTGAGGCTTGCTGG - Intergenic
927217096 2:20673915-20673937 CTGGAGCAGGTGAAGCCCCCAGG + Intergenic
928688558 2:33775507-33775529 CTGGGGGAGCTGGAGCATCTGGG - Intergenic
929393097 2:41494298-41494320 CAGGGGCAACTGAGGGTTCCTGG + Intergenic
930192496 2:48474730-48474752 CTGGGACAGCTCTAGATTCCTGG - Exonic
930710129 2:54543054-54543076 CTGGAGCACCTGAATGTTCCTGG + Intronic
930839163 2:55826240-55826262 TTAGGGCAGCTGTAGCTTGCTGG - Intergenic
934052953 2:88225506-88225528 CTGGTGCAGGAGCAGCTTCCTGG + Intergenic
934603617 2:95678080-95678102 CAGGTGCAACTGGAGCTTCCAGG - Intergenic
934677645 2:96260945-96260967 CTGGGGCAGCTGACACTGCCAGG - Intronic
935417927 2:102838048-102838070 CTGGGGCAGGGCCAGCTTCCGGG - Intronic
936068973 2:109353010-109353032 GTGGGGCAGCTGCAGCGGCCAGG - Intronic
936398794 2:112150267-112150289 CAGGGGCAGTTGAGGCTTTCTGG - Intronic
936536999 2:113320316-113320338 CAGGTGCAACTGGAGCTTCCAGG - Intergenic
936734217 2:115420771-115420793 CTGTGGCAGCAGGAACTTCCTGG + Intronic
938195054 2:129319493-129319515 TTTGGGCAGCTGCAGCTGCCCGG + Intergenic
938661847 2:133494968-133494990 GTTGTGCAGATGAAGCTTCCAGG - Intronic
939872378 2:147539902-147539924 ATGGGGAAACTGAAGCTTCAAGG - Intergenic
942135351 2:172919669-172919691 CAGGGGCAGCCTAAGTTTCCAGG + Intronic
943002125 2:182341515-182341537 CTGGGGCTGCTGAATCTTCAGGG - Intronic
943033308 2:182711536-182711558 CTGGGGCTGCTGTTGCTTCCAGG - Intergenic
945264646 2:207878869-207878891 CAGGGGCAGAAGAGGCTTCCGGG - Intronic
947444778 2:230155479-230155501 CTGTGGCACCTGAAGCCTCGTGG + Intergenic
947705670 2:232273625-232273647 CTGGGGGTGCCGAAGTTTCCTGG - Intronic
948274036 2:236694772-236694794 CAGGGGCTACTGCAGCTTCCTGG + Intergenic
948356153 2:237378995-237379017 CTGAGGCAGCTGCAGCTCCAGGG - Exonic
948476212 2:238221439-238221461 CTGGGGCAGGAGCAGCTCCCCGG - Intergenic
949066990 2:241997478-241997500 TTGGGGTTGCTGGAGCTTCCTGG + Intergenic
1169926991 20:10793879-10793901 CTGGGGCACATGAGGCTGCCAGG - Intergenic
1171208683 20:23300671-23300693 CTGGGGCAACTGAAGATTTCTGG - Intergenic
1171958442 20:31476613-31476635 CTGGGGCAGGTGAAGGTTTCTGG - Exonic
1173646211 20:44634687-44634709 CTGGGGCAGAAGAAGGTCCCTGG + Intronic
1174037441 20:47677004-47677026 GTGGGGCTACAGAAGCTTCCTGG + Intronic
1174112354 20:48205363-48205385 CTTTGTCAGCTGAGGCTTCCCGG + Intergenic
1174168870 20:48604124-48604146 CTTTGTCGGCTGAAGCTTCCTGG - Intergenic
1174280189 20:49433685-49433707 CTGGGGCAGATGAAGCTCCCAGG + Intronic
1175345089 20:58267328-58267350 GTGCGGCAGCTGATGCTTTCTGG - Intergenic
1175753792 20:61516530-61516552 CTGAGGCAGATGTAGTTTCCAGG - Intronic
1176092681 20:63325962-63325984 GTGAGGCAGCTGAGGCTGCCAGG - Intronic
1176136900 20:63527260-63527282 GTGGGGCAGCTTCAGCTTACAGG - Intergenic
1177624958 21:23646974-23646996 CTGGGGCAGATGGAAATTCCTGG + Intergenic
1178526615 21:33334990-33335012 CTTGGGCAGGTGACTCTTCCTGG + Intronic
1178943437 21:36926320-36926342 CTGTGGCAGCTGTGACTTCCAGG - Intronic
1179116042 21:38493726-38493748 CAGGGGCAGGTGGAGCGTCCAGG - Intronic
1179725995 21:43341538-43341560 CTGGGGCAGTGGCAGCTGCCCGG - Intergenic
1179729146 21:43357894-43357916 CGGAAGCAGCTGAAGGTTCCAGG + Intergenic
1180861746 22:19087152-19087174 CTTGGGCTGCTGAAGTTCCCTGG - Intronic
1180985617 22:19902526-19902548 CTGGGGCATCTGCAGCTTGGCGG - Intronic
1182704727 22:32269999-32270021 CGGGGGCTCCTGAAGCTTCTCGG - Intergenic
1183260892 22:36795159-36795181 CAGGGGAAGCTGACTCTTCCAGG + Intergenic
1184478336 22:44733605-44733627 CTGTGTCAGCTTCAGCTTCCCGG + Intronic
1184607373 22:45581864-45581886 TTGGGGCTGCTGGAGCATCCAGG + Intronic
1185043379 22:48517129-48517151 CTGGGAGAGCAGGAGCTTCCGGG - Intronic
1185297384 22:50061076-50061098 CTGGGGCAGGTGCACCTTGCAGG + Exonic
1185399585 22:50608864-50608886 CTGGGACAGCGGACGCTGCCAGG + Intronic
950034730 3:9877220-9877242 CTGGGGCAGTTGAAGCATCAGGG + Intronic
950715048 3:14842029-14842051 CTTGGGCAGCTGCAGCTTTCTGG + Intronic
951302684 3:21017662-21017684 CAGAGGCAGCTGTATCTTCCAGG - Intergenic
953688027 3:45093542-45093564 CTTGGGCACCAGCAGCTTCCAGG + Exonic
953704841 3:45223406-45223428 AAGGGGCAGCTGAAGCTGCAGGG + Intergenic
953820374 3:46203075-46203097 CTGGGGCTTCTGAGGCTTCTGGG - Exonic
954581192 3:51703779-51703801 GTGTGGCAGCTGAAGTCTCCCGG - Exonic
955051000 3:55410899-55410921 CTAGGGCAGCTTAAGGATCCAGG + Intergenic
956308300 3:67850663-67850685 CTGGGGCAGGAGAAGACTCCAGG - Intergenic
956858354 3:73298018-73298040 CTTGGGCAACTGAGGCTTCAGGG + Intergenic
957919887 3:86733399-86733421 CTGGGGCTGGTGCAGGTTCCAGG - Intergenic
958019461 3:87979246-87979268 CTGGGGCAACTGAAGGTATCTGG - Intergenic
959476656 3:106820951-106820973 CAGGCACAGCTGAAGCCTCCTGG + Intergenic
961217929 3:125175908-125175930 TTGGGGCATCTGAAGGTTCCTGG + Intronic
963155421 3:142091124-142091146 CTCGGGCAGCTGAAGCTTTTAGG + Intronic
963756352 3:149238737-149238759 CTGGAGGAGGTGAGGCTTCCAGG + Intergenic
964662889 3:159140330-159140352 CTGGGGCAGCTGAAGTCACAAGG - Intronic
968362577 3:198157624-198157646 CTGGGGAAGCTGTGGCTTCATGG + Intergenic
968438733 4:610615-610637 GTGGAGCAGCTGAGGCCTCCTGG + Intergenic
968884555 4:3320746-3320768 TTAGAGCAGCAGAAGCTTCCAGG + Intronic
969172108 4:5372420-5372442 CTGGGCTACCTGAAGCTTCAGGG - Intronic
969214830 4:5713095-5713117 CTGAGTCAGCTGAGGCTTACCGG + Intronic
969272315 4:6111157-6111179 CTGGGCCAGATCCAGCTTCCAGG - Intronic
969564973 4:7972047-7972069 CTGGGAGGGCTGGAGCTTCCGGG - Intronic
969667413 4:8568198-8568220 ATGGTGCAGATGAAGCCTCCAGG + Intronic
974617293 4:64306345-64306367 CTGGGGCAACTGAAGGTATCTGG + Intronic
979919420 4:126479157-126479179 CTGGGGCAGCTGTAGGCACCTGG + Intergenic
980017885 4:127674393-127674415 CTGGCCCAGCTGAGGCTTCATGG - Intronic
980813872 4:137917970-137917992 CTGAGGCACCTGAGGCTTCTTGG + Intergenic
981613631 4:146623054-146623076 CAGGGGCATCTGAAGATTCAGGG - Intergenic
982391744 4:154872176-154872198 GTGATGCAGATGAAGCTTCCAGG + Intergenic
982604748 4:157500185-157500207 CTTGGGCAACTGAGGCTTTCTGG + Intergenic
982696793 4:158611174-158611196 TTGGGGAAGCTGAGGCTTACAGG + Intronic
983915774 4:173289114-173289136 CTAGGGCAACTGAAGGTTTCTGG - Intronic
984888898 4:184474123-184474145 CTGGGGCTGCTGAGGCTGCGAGG - Intronic
985026927 4:185747551-185747573 CAGGGGCAGCACAAGCTTCCAGG + Intronic
985707648 5:1410665-1410687 ATGGGGTAGCTGAGGCTTCCAGG + Intronic
985818284 5:2142842-2142864 CTTGGGGAGCTCCAGCTTCCGGG + Intergenic
986029553 5:3881853-3881875 CTGGGGTAGCGGAGGCTTCCTGG - Intergenic
986094417 5:4540792-4540814 CTGAGGCAGCTGAAGTTTTCTGG + Intergenic
987999482 5:25330670-25330692 CTGGTGCAGCTGCAGCCACCCGG + Intergenic
988805754 5:34738954-34738976 TGGTGGCAGCTGAAGCTTCTGGG + Intronic
988893956 5:35651408-35651430 CTGGGGCAGCTGAAGTCCCTGGG + Intronic
991449063 5:66732431-66732453 CTGGGTCAGCAAAGGCTTCCAGG - Intronic
994069314 5:95580689-95580711 CTGGGCCAGCCCAACCTTCCTGG - Intronic
994820555 5:104645425-104645447 CTGGAGCAGGTTAATCTTCCTGG - Intergenic
995072399 5:107939842-107939864 CTGGGTCAGCTGAGCCCTCCTGG - Intronic
995181187 5:109231650-109231672 CTGGGGCAGCTGGAGCCCCTAGG - Intergenic
995566526 5:113436744-113436766 CTTAGGCAGATGAAGCCTCCAGG - Intronic
995870902 5:116742363-116742385 CTGGGGCAATTGAAAGTTCCAGG + Intergenic
997742482 5:136269257-136269279 CTGGCTCACCCGAAGCTTCCTGG + Intronic
998570639 5:143253748-143253770 CTGGGGCAACTGAGGATTTCTGG - Intergenic
999956581 5:156709788-156709810 ATGGGGCAGTTGAAACTTCTTGG + Intronic
1001476615 5:172055115-172055137 ATGAGGCTGATGAAGCTTCCAGG + Intronic
1001539865 5:172530222-172530244 CTGGGGGCCCTGAATCTTCCAGG + Intergenic
1002549801 5:179979139-179979161 TTGTGGCAGCTGAGGCTACCAGG + Intronic
1002813415 6:656627-656649 GTGGGTCAGCTGCAGCTTCAGGG + Exonic
1003733872 6:8855683-8855705 CTGGAGTAACTGAAGGTTCCTGG - Intergenic
1004251544 6:14026821-14026843 CATGGGCAGCTGGAGCTTGCCGG + Intergenic
1004330583 6:14717024-14717046 CTGCAGCAGCTGAAGCAGCCAGG + Intergenic
1004915554 6:20328689-20328711 CTGAGGCTGCTGGAGCTTCTGGG + Intergenic
1005493519 6:26368891-26368913 CTGGTGGAGCTGAAGGTTGCAGG + Exonic
1005498090 6:26406235-26406257 CTGGTGGAGCTGAAGGTTGCAGG + Exonic
1005502756 6:26444283-26444305 CTGGTGGAGCTGAAGGTTGCAGG + Exonic
1005710568 6:28500259-28500281 CTGGAGCAACTGCAGGTTCCTGG + Intergenic
1006867738 6:37222599-37222621 CAGGTGCAGCTGCAGCTGCCAGG - Intronic
1006901173 6:37502705-37502727 ATGTGGAAGCTGAAGCTTACGGG - Intergenic
1008688004 6:53945788-53945810 CCAGGGCACCTGAAGCTGCCTGG - Intronic
1008763564 6:54883034-54883056 CTGAGGCAGGAGAAGCTCCCGGG - Intronic
1010940421 6:81910754-81910776 TTGGGCCAGCTGAAGGTGCCAGG - Intergenic
1011814934 6:91178399-91178421 CTGAGGCAGCTGATTCTCCCAGG + Intergenic
1015890438 6:137964974-137964996 CCTGGGCAGCTGGAGCTTCTAGG + Intergenic
1016120940 6:140340483-140340505 CTGGGGCAACTGAAGGTATCTGG - Intergenic
1017705880 6:157122602-157122624 CTGGGGCAGCAGAACCTGCCAGG + Intronic
1018170157 6:161138097-161138119 CCGGGGCAGCTGCAGGTGCCAGG - Intronic
1018245923 6:161823774-161823796 CTGCTGAAGCTGAAGCTTCAGGG + Intronic
1018739403 6:166715707-166715729 TGGAGGCAGCTGCAGCTTCCTGG + Intronic
1018747046 6:166770431-166770453 GTGGGGGTGCTGAAGCTGCCTGG - Intronic
1019253105 7:31083-31105 CTGGGGAAGCTGTGGCTTCATGG - Intergenic
1019301576 7:306835-306857 CTGGGGGAGCTGAGGGTGCCCGG - Intergenic
1019302255 7:311789-311811 CTGGGGGAGCTGAGGGTGCCCGG + Intergenic
1020457996 7:8396121-8396143 CTGTGGCAGTTGAAGGTTCAAGG + Intergenic
1020804293 7:12769317-12769339 CTGGGGCAGAAGAAGCCTCTAGG + Intergenic
1024141948 7:46470653-46470675 CTGGTGCAACTGAAGGTTTCTGG - Intergenic
1024676027 7:51638558-51638580 ATGGGGCAGCTGGAACTGCCAGG - Intergenic
1025731581 7:64113192-64113214 CAGGGCCAGCTGAAGGTACCGGG + Intronic
1027252603 7:76408560-76408582 GTGGGGAAGCTGAGGATTCCTGG - Intronic
1028351609 7:89856915-89856937 CTGGGGCAACTGAGGATTTCTGG + Intergenic
1030200887 7:106902308-106902330 TTGGGTCAGCTGCAGCTTGCTGG + Intronic
1032748213 7:134809286-134809308 TTTGGGCAGCTGAAGCTGACGGG + Intronic
1033094024 7:138414080-138414102 CTGCGCCTGCTGAATCTTCCTGG + Intergenic
1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG + Exonic
1034523507 7:151639296-151639318 CTGGAGGAGCTCAAGCTGCCCGG - Intronic
1035209672 7:157318516-157318538 CTGGCTCAGCTGAGGGTTCCTGG + Intergenic
1035241276 7:157531261-157531283 CAGGGAAAGCAGAAGCTTCCCGG + Intergenic
1035683045 8:1502870-1502892 CTGGGGCAGCAGGAGGTACCTGG + Intronic
1036751574 8:11446870-11446892 CTGGGGCAGCTGCACCTACAGGG + Intronic
1040417191 8:47205979-47206001 CTGTGGCAGCTGAAAATACCTGG - Intergenic
1040468851 8:47719600-47719622 CTGGGCCAGCTGTAGCTGCTTGG - Intronic
1040525981 8:48225694-48225716 CTGGGGCAACTGAGGATTTCTGG + Intergenic
1041931992 8:63296978-63297000 CTGGAGCTGCTGAAGCTATCAGG - Intergenic
1042184469 8:66123066-66123088 CTTGTGCAGAAGAAGCTTCCGGG - Intergenic
1042683656 8:71414066-71414088 CTGGGGCAGCTGAAGCTTCCTGG - Intronic
1045390012 8:101705785-101705807 CTGGAGCAGCTGAGGCTTCTTGG - Intronic
1045797069 8:106058620-106058642 CTGGAGCAGCTGAGGTTTCTGGG - Intergenic
1047643836 8:126849384-126849406 GTGGGACAGCTGAAGCTTCCTGG + Intergenic
1049299440 8:141861921-141861943 CTGGGAAACCTGTAGCTTCCAGG - Intergenic
1049427248 8:142542972-142542994 CTGGGTCAGCTGCAGGCTCCAGG - Intronic
1049449859 8:142654804-142654826 CTGGGGCAGCTCAAGGCTCTTGG - Intergenic
1049804473 8:144532691-144532713 CTGGGGAAACTGAGGCTTGCAGG - Intronic
1049995059 9:1026820-1026842 CTGGGGCAGCCCACTCTTCCTGG + Intergenic
1052215858 9:25964793-25964815 CTGGGGAAGCTGAAGATTTCTGG - Intergenic
1052966149 9:34342009-34342031 CTGGGGAAGCTGAAGATTTGTGG + Intronic
1053053943 9:34982634-34982656 CCGGGGCAGCTGCAGCTGCCAGG + Intergenic
1053307449 9:36994545-36994567 CTGTGGCAGCTGAAGCTAATGGG - Intronic
1054873784 9:70074469-70074491 CTGGGACAGGTGAGGCATCCAGG - Intronic
1056541689 9:87576973-87576995 ATGGGGCAGCTGCAGGTTGCTGG - Intronic
1059452110 9:114376999-114377021 CTGGGGGAGCTGAGGAGTCCTGG + Exonic
1059974178 9:119698173-119698195 ACGGGCCAGCTGCAGCTTCCTGG + Intergenic
1060472602 9:123961024-123961046 CAGGGGTACCTGAAGCTTCCAGG + Intergenic
1061218878 9:129237419-129237441 TTGGGGGAACTGAAGCTTCTCGG - Intergenic
1061458077 9:130713272-130713294 TTGGGGCAGCTGAGGCGGCCGGG + Intergenic
1061882412 9:133574910-133574932 CTGGGGCTGCTGCAGCTTCTGGG + Exonic
1062049240 9:134438599-134438621 CAGGGGCAGCTGGGGCTTCCTGG - Intronic
1062318191 9:135978350-135978372 CTAGGGCTGCTGAAGGTTCTGGG - Intergenic
1062401075 9:136372906-136372928 CTGGGGCAGGAGAAGAGTCCAGG - Intronic
1062576967 9:137213447-137213469 TTGAGGCAGCTGAGGCCTCCAGG - Intronic
1062747265 9:138221283-138221305 CTGGGGAAGCTGTGGCTTCATGG + Intergenic
1186510403 X:10125853-10125875 CTGAAGCAGCGGATGCTTCCAGG - Intronic
1186672672 X:11782881-11782903 CTGGTGAAGCTGAAACTTCAGGG + Intergenic
1189703823 X:43739611-43739633 CGGGGGGAGCTCAAGCTTACTGG - Intronic
1192200118 X:69061238-69061260 CTTGGGCAGCAGAGGCTTCTGGG - Intergenic
1193198199 X:78658084-78658106 CTGGGGCTGCTGGGGCCTCCTGG + Exonic
1193348666 X:80432294-80432316 CTGGGGCAACTGAAGGTATCTGG - Intronic
1193714898 X:84926739-84926761 ATGGGTCAGCTGTAGCTTCTTGG + Intergenic
1194965590 X:100285225-100285247 CTGGGAGTGCTGATGCTTCCTGG - Intergenic
1195722330 X:107878656-107878678 CTGGGGCAGCTGAAGGCATCTGG - Intronic
1196988928 X:121306213-121306235 TTGGGGCAGGTAAACCTTCCTGG + Intergenic
1200060079 X:153480230-153480252 CCAGGGCTGCTGAAGCTCCCTGG + Intronic
1200292626 X:154886877-154886899 CTGGGGCAGCTGGAGCTGGGCGG - Exonic
1200339470 X:155382617-155382639 CTGGGGCAGCTGGAGCTGGGCGG - Exonic
1200347000 X:155458076-155458098 CTGGGGCAGCTGGAGCTGGGCGG + Exonic
1201194590 Y:11479478-11479500 ATCGTGCAGATGAAGCTTCCAGG + Intergenic
1201260709 Y:12156539-12156561 ATGAGGCAGATGAAGCCTCCAGG + Intergenic
1202016047 Y:20407812-20407834 CTAGGGCAACTGAAGGTTTCTGG - Intergenic