ID: 1042683660

View in Genome Browser
Species Human (GRCh38)
Location 8:71414083-71414105
Sequence TATGTAGGGCCTTCCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683660_1042683669 14 Left 1042683660 8:71414083-71414105 CCCCAGAGGGAAGGCCCTACATA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1042683669 8:71414120-71414142 GAGCTACAGGCCAGGCCATCAGG No data
1042683660_1042683665 -8 Left 1042683660 8:71414083-71414105 CCCCAGAGGGAAGGCCCTACATA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
1042683660_1042683668 6 Left 1042683660 8:71414083-71414105 CCCCAGAGGGAAGGCCCTACATA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683660_1042683666 1 Left 1042683660 8:71414083-71414105 CCCCAGAGGGAAGGCCCTACATA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1042683666 8:71414107-71414129 TTATCCTGAGTAGGAGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683660 Original CRISPR TATGTAGGGCCTTCCCTCTG GGG (reversed) Intronic
900193217 1:1360165-1360187 TCTGCAGGGCCGTCCCTCTCCGG + Intronic
903440575 1:23385038-23385060 TATTTAGGACTTTCCCTCTCTGG - Intronic
904342721 1:29847766-29847788 TAAAAAGGGCCTTCCTTCTGGGG + Intergenic
907594898 1:55710761-55710783 AATGTAAGTTCTTCCCTCTGTGG - Intergenic
915705772 1:157842162-157842184 TTTCTAGGCACTTCCCTCTGGGG - Intronic
915940228 1:160114244-160114266 TCTGCAGGGAGTTCCCTCTGGGG + Intergenic
916725096 1:167516521-167516543 TATGTGCGGCCTTTCCTCCGGGG + Intronic
918180694 1:182084245-182084267 TATGCAGACACTTCCCTCTGGGG + Intergenic
919188474 1:194184931-194184953 TTTGTAGGTCCTTTTCTCTGGGG + Intergenic
920403826 1:205694085-205694107 TCTGTGGGGGCTTCCCTCTGGGG + Intergenic
920575889 1:207060000-207060022 TGTGCAGGGCCTTCCCTCATTGG + Intronic
922450550 1:225733781-225733803 TATTTGGGGCCTTGGCTCTGAGG + Intergenic
1072309755 10:94143073-94143095 GGTATAGGGACTTCCCTCTGGGG - Intronic
1074438180 10:113452347-113452369 TAAAAAGGGCCTTCCCTCAGGGG + Intergenic
1074505506 10:114066983-114067005 TGTGAAGGCCCTTCCCTCTCTGG - Intergenic
1076049819 10:127323543-127323565 TCTGTGGGGTCTTCCCTCTGTGG + Intronic
1081924521 11:46813688-46813710 TATGTAGTCCCATCCCTGTGTGG - Intronic
1084379585 11:68802970-68802992 TAGGTAGTGCCTTGCCCCTGGGG + Intronic
1084645934 11:70457906-70457928 TGGGTAGGGCCTTTCCTCTGGGG - Intergenic
1085100588 11:73796744-73796766 CATGTACTTCCTTCCCTCTGAGG + Intronic
1089121396 11:116138186-116138208 TATGCAGAGCCTTCCTCCTGGGG - Intergenic
1089464164 11:118673390-118673412 TGTGCAGGGCCTTCCCTCCAAGG + Intronic
1090873902 11:130771836-130771858 TCTGTACCTCCTTCCCTCTGGGG - Intergenic
1091543358 12:1482883-1482905 TAGGTGGGGGCTTCCCTTTGGGG - Intronic
1091856505 12:3745059-3745081 GTTGGATGGCCTTCCCTCTGTGG + Intronic
1096916452 12:55038664-55038686 CAGGTAGCCCCTTCCCTCTGAGG - Intergenic
1112791010 13:103002209-103002231 TATCTGGGGCCTTCCCTTTAAGG - Intergenic
1117961540 14:61168066-61168088 TTTGTAGGGCCTTACCACTCTGG - Intergenic
1122401342 14:101469357-101469379 TGTCCAGGGCCTTCCCTGTGAGG + Intergenic
1122413929 14:101539559-101539581 TGTGTAAGCCCTTCCCCCTGAGG + Intergenic
1124784867 15:32670298-32670320 TATGTGGGGCAGTCCCTGTGAGG + Intronic
1132122588 15:99190649-99190671 TATGTAGTGCCTTTCATTTGTGG - Intronic
1138208106 16:55139831-55139853 TCTCTAGGGCCTTTTCTCTGTGG - Intergenic
1141740831 16:85891748-85891770 CAGGTAGGGCAATCCCTCTGAGG + Intergenic
1142888434 17:2927804-2927826 CATAGCGGGCCTTCCCTCTGTGG + Intronic
1144576937 17:16435397-16435419 TATGCAGGGCAGTTCCTCTGAGG - Intronic
1145217966 17:21066441-21066463 AATGTAGGGCTTTACCTCTGTGG - Intergenic
1147266632 17:39238302-39238324 TATGCCAGACCTTCCCTCTGGGG - Intergenic
1147349205 17:39826911-39826933 TGTGTGGGGTCTTCCCCCTGGGG - Intronic
1149066020 17:52480055-52480077 TACGTAGGGCCTTTCGTGTGTGG + Intergenic
1153347061 18:4038358-4038380 TATGTATGGGCTTCAGTCTGGGG + Intronic
1156685998 18:39647537-39647559 AATGAAGGGCCTTGCCTCAGAGG - Intergenic
1156733645 18:40226551-40226573 TTGGTAGGGCCTTTCATCTGAGG - Intergenic
1158112195 18:53952554-53952576 TATGTATGGCCTTCCATCTATGG - Intergenic
1160792267 19:928220-928242 CATGATGTGCCTTCCCTCTGGGG + Intronic
1164780145 19:30885240-30885262 CCTGTTGGGCTTTCCCTCTGAGG - Intergenic
1166846108 19:45729807-45729829 CATGTAGGGGCTCCCCACTGTGG - Intronic
925844108 2:8020374-8020396 TGGGCAGGGTCTTCCCTCTGGGG - Intergenic
929233548 2:39584371-39584393 TGTGTAGAGCCTTCTCTCAGTGG + Intergenic
929666513 2:43838264-43838286 TGTCTACGGCCTGCCCTCTGTGG - Intronic
930702738 2:54475430-54475452 TATGCAGTCCCTTCTCTCTGTGG + Intronic
930777002 2:55182941-55182963 TTTTTAGGGCCTTCCCTCACTGG - Intronic
931121527 2:59225576-59225598 TTTTTAGGGCCCTGCCTCTGGGG - Intergenic
932319698 2:70812671-70812693 TCTCTAGGGCCTGCCCACTGAGG + Intronic
932838798 2:75061808-75061830 TCAGTGTGGCCTTCCCTCTGAGG - Intronic
941449880 2:165647104-165647126 TATGTAATGCTTTCCATCTGTGG + Intronic
942128790 2:172856741-172856763 AATCTGGGGCTTTCCCTCTGTGG + Intronic
945269772 2:207926325-207926347 TTTGTGGGGCCATCCCTGTGAGG + Intronic
945416004 2:209573744-209573766 TGCGTAGGGCCTTCTTTCTGGGG - Intronic
947738735 2:232474908-232474930 CATGTTGGGGCTTCTCTCTGGGG - Intergenic
947857773 2:233335861-233335883 TATGCTGGGGGTTCCCTCTGTGG + Intronic
948965490 2:241376497-241376519 TGTGTAGGGCCTGCCCTGAGTGG + Intronic
1172806029 20:37612490-37612512 TATCAAGGCCCTTCTCTCTGGGG - Intergenic
1176248173 20:64107259-64107281 TCTGAAGGTCCTTCCCTCAGGGG + Intergenic
1181185472 22:21100422-21100444 TATGAGGGCCCTTCCCTATGTGG + Intergenic
1183115048 22:35685419-35685441 GATGGACGCCCTTCCCTCTGGGG - Intergenic
949536040 3:4996955-4996977 TATGCAGGGGCTTCCCTGTAGGG + Intergenic
957183960 3:76917653-76917675 TTTGTAGGGCCTTCTCATTGAGG + Intronic
958648190 3:96900335-96900357 TATGTAGTTTCTTCCCTCTATGG - Intronic
960739870 3:120821283-120821305 TCTGTAGGGCCTCCCCTCATAGG - Intergenic
960820087 3:121721208-121721230 TTAGTAGTGCCTTCTCTCTGTGG - Intronic
962756966 3:138472477-138472499 TCTGTAGGGCCTTCTTCCTGAGG - Exonic
963566038 3:146932370-146932392 TATGTAAGGTCTTCCCTCACTGG - Intergenic
968908140 4:3463842-3463864 TATGTGGGGCTTTGCTTCTGGGG - Intronic
970227969 4:13879574-13879596 TATGAAGGACCTACCCTTTGTGG + Intergenic
972529769 4:39950921-39950943 TAGATAGGGTCTCCCCTCTGTGG + Intronic
972808046 4:42550723-42550745 TATGTAGTGCCATCTCACTGTGG + Intronic
976716760 4:88131003-88131025 TAAGTAGGACTTTCCCTGTGTGG - Intronic
994569454 5:101496714-101496736 TATGTAGCGGCTTCCCACTGTGG - Intergenic
1003246019 6:4382878-4382900 GGTGTAGAGCCTTTCCTCTGTGG - Intergenic
1004334049 6:14747872-14747894 TATGTAGGGGCTACCCTCTTGGG - Intergenic
1006991147 6:38215970-38215992 TATTGAGGGCCTTCCCCCTGGGG - Intronic
1010596375 6:77769009-77769031 TATGAAGGTCCTTTCCTGTGTGG - Intronic
1012382897 6:98641266-98641288 TAAATAGGGGCTTCCATCTGAGG - Intergenic
1012451062 6:99352592-99352614 TATGCAGGGCCTCCCTACTGAGG + Intergenic
1014763027 6:125378796-125378818 AATGCAGGGACTTCCCTATGGGG + Intergenic
1016927497 6:149366391-149366413 AATTTAGGGCCTCCTCTCTGTGG + Intronic
1021188256 7:17590849-17590871 TGTGAAGGGCCTTCCTTATGAGG - Intergenic
1022498816 7:30869868-30869890 TATGGATTGCCTTCTCTCTGGGG + Intronic
1039835638 8:41254227-41254249 TATGTAGGGGCTTCCAGCAGAGG + Intergenic
1042683660 8:71414083-71414105 TATGTAGGGCCTTCCCTCTGGGG - Intronic
1044693454 8:94900460-94900482 TTTTAAGGGCCCTCCCTCTGAGG - Intronic
1049022977 8:139970515-139970537 TATGAAGGGGCCTCTCTCTGGGG - Intronic
1049058992 8:140261332-140261354 GATGTAGCCCCTGCCCTCTGGGG + Intronic
1055980065 9:81992375-81992397 TTTGTGGGGCTTACCCTCTGTGG + Exonic
1058070022 9:100592274-100592296 GATGGAGTGCCTTCTCTCTGTGG + Intergenic
1058413610 9:104762871-104762893 TATGTGTTGCCTTCCTTCTGTGG - Intergenic
1188243063 X:27811688-27811710 TCTGAAGGGCCTTTCCCCTGAGG - Intronic
1191651863 X:63547567-63547589 TATATATGGCCTTCCCTTTTGGG - Intergenic
1196348590 X:114699018-114699040 TATATAGAGACTCCCCTCTGTGG - Intronic
1199634824 X:149805263-149805285 TATTTGGGGTCTTCCCTCTGGGG - Intergenic