ID: 1042683660

View in Genome Browser
Species Human (GRCh38)
Location 8:71414083-71414105
Sequence TATGTAGGGCCTTCCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683660_1042683669 14 Left 1042683660 8:71414083-71414105 CCCCAGAGGGAAGGCCCTACATA No data
Right 1042683669 8:71414120-71414142 GAGCTACAGGCCAGGCCATCAGG No data
1042683660_1042683668 6 Left 1042683660 8:71414083-71414105 CCCCAGAGGGAAGGCCCTACATA No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683660_1042683665 -8 Left 1042683660 8:71414083-71414105 CCCCAGAGGGAAGGCCCTACATA No data
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
1042683660_1042683666 1 Left 1042683660 8:71414083-71414105 CCCCAGAGGGAAGGCCCTACATA No data
Right 1042683666 8:71414107-71414129 TTATCCTGAGTAGGAGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683660 Original CRISPR TATGTAGGGCCTTCCCTCTG GGG (reversed) Intronic