ID: 1042683661

View in Genome Browser
Species Human (GRCh38)
Location 8:71414084-71414106
Sequence CTATGTAGGGCCTTCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683661_1042683666 0 Left 1042683661 8:71414084-71414106 CCCAGAGGGAAGGCCCTACATAG No data
Right 1042683666 8:71414107-71414129 TTATCCTGAGTAGGAGCTACAGG No data
1042683661_1042683665 -9 Left 1042683661 8:71414084-71414106 CCCAGAGGGAAGGCCCTACATAG No data
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
1042683661_1042683668 5 Left 1042683661 8:71414084-71414106 CCCAGAGGGAAGGCCCTACATAG No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683661_1042683669 13 Left 1042683661 8:71414084-71414106 CCCAGAGGGAAGGCCCTACATAG No data
Right 1042683669 8:71414120-71414142 GAGCTACAGGCCAGGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683661 Original CRISPR CTATGTAGGGCCTTCCCTCT GGG (reversed) Intronic