ID: 1042683661

View in Genome Browser
Species Human (GRCh38)
Location 8:71414084-71414106
Sequence CTATGTAGGGCCTTCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683661_1042683666 0 Left 1042683661 8:71414084-71414106 CCCAGAGGGAAGGCCCTACATAG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1042683666 8:71414107-71414129 TTATCCTGAGTAGGAGCTACAGG No data
1042683661_1042683668 5 Left 1042683661 8:71414084-71414106 CCCAGAGGGAAGGCCCTACATAG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683661_1042683669 13 Left 1042683661 8:71414084-71414106 CCCAGAGGGAAGGCCCTACATAG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1042683669 8:71414120-71414142 GAGCTACAGGCCAGGCCATCAGG No data
1042683661_1042683665 -9 Left 1042683661 8:71414084-71414106 CCCAGAGGGAAGGCCCTACATAG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683661 Original CRISPR CTATGTAGGGCCTTCCCTCT GGG (reversed) Intronic
901219241 1:7573669-7573691 CTTTGCAGGGCCTTCTCCCTGGG + Intronic
901401412 1:9017442-9017464 CTCTGTACAGCCTTCCTTCTGGG - Intronic
904342720 1:29847765-29847787 CTAAAAAGGGCCTTCCTTCTGGG + Intergenic
905409499 1:37758542-37758564 CTCTGTAGGGCATTCCTTCCTGG + Intronic
908607796 1:65819204-65819226 CTCTGTGGTGCCATCCCTCTAGG - Intronic
911093157 1:94033872-94033894 CTATGGCTGGCCCTCCCTCTGGG + Intronic
915940227 1:160114243-160114265 CTCTGCAGGGAGTTCCCTCTGGG + Intergenic
916725095 1:167516520-167516542 CTATGTGCGGCCTTTCCTCCGGG + Intronic
918180693 1:182084244-182084266 CTATGCAGACACTTCCCTCTGGG + Intergenic
919188473 1:194184930-194184952 CTTTGTAGGTCCTTTTCTCTGGG + Intergenic
920403825 1:205694084-205694106 CTCTGTGGGGGCTTCCCTCTGGG + Intergenic
921824172 1:219653247-219653269 CTATGTATGGCTTTCTCTCTGGG - Intergenic
1067381470 10:45777587-45777609 CTCTGCAGGGCCTTTCCTCCCGG + Intronic
1067889169 10:50118221-50118243 CTCTGCAGGGCCTTTCCTCCCGG + Intronic
1071239130 10:83684429-83684451 TTATGGAGAGCCTTCCTTCTTGG - Intergenic
1074438179 10:113452346-113452368 CTAAAAAGGGCCTTCCCTCAGGG + Intergenic
1084379584 11:68802969-68802991 CTAGGTAGTGCCTTGCCCCTGGG + Intronic
1084645935 11:70457907-70457929 ATGGGTAGGGCCTTTCCTCTGGG - Intergenic
1086253523 11:84846675-84846697 CTATGTAGTCCCTTCCCACAAGG + Intronic
1089064491 11:115652249-115652271 CTGGGTAGGGCCTTCCATGTAGG + Intergenic
1089292673 11:117447672-117447694 CTGTGTATGGCCTTGGCTCTAGG - Intronic
1090873903 11:130771837-130771859 CTCTGTACCTCCTTCCCTCTGGG - Intergenic
1093198320 12:16156194-16156216 CAATATAGAGCCTTCTCTCTTGG - Intergenic
1110073585 13:71210027-71210049 CTTTGTAGCACCTTACCTCTAGG - Intergenic
1110286538 13:73756074-73756096 CTATGAAGAGTCTTACCTCTTGG + Intronic
1116048409 14:39773607-39773629 CTATGCACGGCCTGCCCGCTTGG - Intergenic
1118378162 14:65194914-65194936 CTATGTAAGCTCTTCCCTTTTGG + Intergenic
1119849624 14:77857937-77857959 CTATGAAGGTCCTACCTTCTAGG - Intronic
1119888556 14:78164954-78164976 CAATGTAGGTTCTGCCCTCTCGG + Intergenic
1128688651 15:69706603-69706625 CTATGTAGGTTTTTCCCTCCTGG + Intergenic
1130196330 15:81783300-81783322 CGATGTAGGGCCATGCCTCCAGG + Intergenic
1132342726 15:101088415-101088437 CTCTGTAGGGCCTTGTCACTTGG - Intergenic
1141134319 16:81455842-81455864 CTAGGCAGGGCCTTCCCACCAGG - Intronic
1147266633 17:39238303-39238325 CTATGCCAGACCTTCCCTCTGGG - Intergenic
1148828431 17:50412262-50412284 GTAGGTAGTGCCTTCCCTCATGG - Intergenic
1156964813 18:43078351-43078373 CTATGTAGACCCTTCTCTCTAGG - Intronic
1160792266 19:928219-928241 CCATGATGTGCCTTCCCTCTGGG + Intronic
1162043404 19:7983906-7983928 CAGGGTAGGGCCTACCCTCTTGG + Intronic
1164511071 19:28897658-28897680 CCATGTAGGCTCTTCCCTCATGG - Intergenic
1166638810 19:44475700-44475722 TTATGTTGGGCCTTCCTTTTTGG - Exonic
1167300525 19:48674932-48674954 CTGGGTAGGGCCTGCCCTCCCGG + Intergenic
925737072 2:6972773-6972795 CTCTGTAGGTCCTTTTCTCTGGG - Intronic
925844109 2:8020375-8020397 CTGGGCAGGGTCTTCCCTCTGGG - Intergenic
932008161 2:67948359-67948381 ATATGTAGGGCTTTTCCACTTGG - Intergenic
934609505 2:95724202-95724224 CTGTCTAGGACCTTTCCTCTGGG - Intergenic
946171373 2:217898013-217898035 CTATCTGGGGCCTTCCCTGTGGG - Intronic
1169804196 20:9542587-9542609 TTGTGTAGGTCCTTCACTCTTGG + Exonic
1169873315 20:10270320-10270342 GTCTGTAGGACCTTCTCTCTTGG - Intronic
1176180833 20:63748574-63748596 CTCTGTGGGTCCTGCCCTCTCGG - Intronic
1178521742 21:33292710-33292732 CTATGTTGTGACTTTCCTCTTGG + Intronic
1181444760 22:22960409-22960431 CTATGTCCTGCCTTTCCTCTTGG - Intergenic
1182599015 22:31445182-31445204 CTAGGGAGGGCCTTCATTCTTGG + Intronic
1182791900 22:32960145-32960167 CTAGGAAGGGCATTCCCTCCAGG - Intronic
949536039 3:4996954-4996976 CTATGCAGGGGCTTCCCTGTAGG + Intergenic
950546706 3:13642364-13642386 CCATGCAAGGCCTTCCCTCATGG + Intergenic
954302216 3:49706058-49706080 CTATGTGGGCCTTACCCTCTTGG - Exonic
956764801 3:72475497-72475519 CTCTGTAGGCCCTGCCCGCTGGG + Intergenic
961628631 3:128280675-128280697 CTCTGTACGGTCTTCCCTCTGGG + Intronic
963036689 3:141036389-141036411 CTATTTAGGGCCTTTGCACTAGG + Intergenic
963830502 3:150003184-150003206 CTATCTAGGGCAGTCTCTCTAGG + Intronic
964774016 3:160255681-160255703 ATGTGTAGGGCCTTCTCCCTGGG - Intronic
965856868 3:173099961-173099983 CTATGTGGGGACTTCCATTTAGG - Intronic
976897115 4:90126784-90126806 TTGTGTAGGGCCTTCCTTGTAGG + Intergenic
978673231 4:111276947-111276969 CTATGTAGGCATTTCACTCTAGG + Intergenic
982740026 4:159047759-159047781 CTATGGAGAGCCCTGCCTCTGGG + Intergenic
990963219 5:61416607-61416629 CCCTGTAGGTCCATCCCTCTTGG + Intronic
999486436 5:152001598-152001620 CAATGCAGGGCCTTCTCTCAAGG - Intergenic
1001650042 5:173309754-173309776 GTATGGAGTGGCTTCCCTCTTGG + Intergenic
1003638079 6:7852860-7852882 CTGTGTAGTCCCTTTCCTCTAGG - Intronic
1004334050 6:14747873-14747895 TTATGTAGGGGCTACCCTCTTGG - Intergenic
1006934762 6:37709764-37709786 CAGTGTAGGGCATGCCCTCTGGG - Intergenic
1006991148 6:38215971-38215993 ATATTGAGGGCCTTCCCCCTGGG - Intronic
1008471329 6:51888593-51888615 ATAAGAAGGGCCTTCCTTCTTGG + Intronic
1009738154 6:67706248-67706270 TTATTTAGTGTCTTCCCTCTTGG + Intergenic
1012631040 6:101468140-101468162 CTCTGTGGGTCCTTCCCACTGGG - Intronic
1029420744 7:100470652-100470674 CAATGCAGGCCCTTCCCTTTAGG + Intronic
1030182232 7:106722016-106722038 ATATGTATGGCCTTAACTCTTGG - Intergenic
1030766982 7:113422128-113422150 CTGTGAAGGACCTTCCCTCCTGG + Intergenic
1032928195 7:136634091-136634113 CTATGTCGTGTCTTCCCTCCTGG + Intergenic
1035587400 8:786423-786445 CTCTGCTGGCCCTTCCCTCTCGG - Intergenic
1036807708 8:11846906-11846928 CTGTGTGGGGCCTTCCATATAGG - Intronic
1037734326 8:21554788-21554810 CTGGGTAGGACCTTCCCCCTCGG + Intergenic
1038325993 8:26573210-26573232 CTTTGCCGGGCCTTCCTTCTTGG - Intronic
1038852709 8:31295666-31295688 CAAGGTAGGGCCTGGCCTCTAGG - Intergenic
1041962582 8:63635957-63635979 CTATGAATGCCCTTCCTTCTGGG - Intergenic
1042683661 8:71414084-71414106 CTATGTAGGGCCTTCCCTCTGGG - Intronic
1046065603 8:109193425-109193447 CTATGTTTGGGCTTCACTCTTGG + Intergenic
1047868395 8:129055112-129055134 CTATGTAGCATCTTCTCTCTGGG - Intergenic
1047991626 8:130292420-130292442 CTTTGTAAAGCCTTCCCTCTGGG - Intronic
1056931322 9:90880398-90880420 CTCTGAAGGGGCTTCCTTCTGGG - Intronic
1060743278 9:126113483-126113505 CTATTTAGGGCCTGCCAGCTTGG - Intergenic
1187152108 X:16690755-16690777 CTCTGTAGGGCTTTCCACCTTGG - Intronic
1191651864 X:63547568-63547590 ATATATATGGCCTTCCCTTTTGG - Intergenic
1192926484 X:75759674-75759696 CCAGGTACGGCCATCCCTCTTGG + Intergenic
1199001135 X:142637751-142637773 CTATGTAGGGCCACTCCTCATGG - Intergenic
1199634825 X:149805264-149805286 TTATTTGGGGTCTTCCCTCTGGG - Intergenic