ID: 1042683662

View in Genome Browser
Species Human (GRCh38)
Location 8:71414085-71414107
Sequence ACTATGTAGGGCCTTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683662_1042683665 -10 Left 1042683662 8:71414085-71414107 CCAGAGGGAAGGCCCTACATAGT 0: 1
1: 0
2: 0
3: 10
4: 64
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
1042683662_1042683669 12 Left 1042683662 8:71414085-71414107 CCAGAGGGAAGGCCCTACATAGT 0: 1
1: 0
2: 0
3: 10
4: 64
Right 1042683669 8:71414120-71414142 GAGCTACAGGCCAGGCCATCAGG No data
1042683662_1042683668 4 Left 1042683662 8:71414085-71414107 CCAGAGGGAAGGCCCTACATAGT 0: 1
1: 0
2: 0
3: 10
4: 64
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683662_1042683666 -1 Left 1042683662 8:71414085-71414107 CCAGAGGGAAGGCCCTACATAGT 0: 1
1: 0
2: 0
3: 10
4: 64
Right 1042683666 8:71414107-71414129 TTATCCTGAGTAGGAGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683662 Original CRISPR ACTATGTAGGGCCTTCCCTC TGG (reversed) Intronic
901097756 1:6695905-6695927 ACTATGTAGGGCTTTGCAGCTGG - Intronic
903184910 1:21623324-21623346 ACTCTGTAGGCCCTTCCAGCTGG + Intronic
910992665 1:93072431-93072453 AGTATGTAGCACCTTCCCTCTGG + Intergenic
916725094 1:167516519-167516541 TCTATGTGCGGCCTTTCCTCCGG + Intronic
918180692 1:182084243-182084265 ACTATGCAGACACTTCCCTCTGG + Intergenic
919188472 1:194184929-194184951 ACTTTGTAGGTCCTTTTCTCTGG + Intergenic
920403824 1:205694083-205694105 CCTCTGTGGGGGCTTCCCTCTGG + Intergenic
921824173 1:219653248-219653270 CCTATGTATGGCTTTCTCTCTGG - Intergenic
924592867 1:245420110-245420132 ACTTTGTAGAGGCATCCCTCTGG + Intronic
1074438178 10:113452345-113452367 CCTAAAAAGGGCCTTCCCTCAGG + Intergenic
1077606246 11:3614790-3614812 CATATGTGGGGACTTCCCTCAGG + Intergenic
1099602903 12:84764010-84764032 ATTATTTAGGGCCCTCACTCTGG + Intergenic
1104629090 12:130384797-130384819 TCTATTTAGGGTCTCCCCTCAGG - Intergenic
1105017387 12:132793998-132794020 AATATGGAGGGCGGTCCCTCAGG + Intronic
1115522733 14:34249029-34249051 ACTTTTTAGGGCCTTCCTTAGGG + Intronic
1124362222 15:29046067-29046089 GCTATGTGGGACCTTCCTTCAGG + Intronic
1124481764 15:30085797-30085819 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124488220 15:30137895-30137917 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124521827 15:30411404-30411426 ATGATGTAGGGCCTTCCCTGTGG + Exonic
1124536837 15:30554815-30554837 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124543311 15:30606869-30606891 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1124755306 15:32400425-32400447 ATGATGTAGGGCCTTCCCTGTGG + Exonic
1124761815 15:32452776-32452798 ATGATGTAGGGCCTTCCCTGTGG + Exonic
1124776814 15:32596292-32596314 ATGATGTAGGGCCTTCCCTGTGG - Exonic
1128379819 15:67104400-67104422 TCTAGGAAGGGCCTGCCCTCAGG + Intronic
1128856713 15:71024043-71024065 ACTAGGTAGGGCCTCCCTGCAGG + Intronic
1138458989 16:57136979-57137001 ACCATGCTGGCCCTTCCCTCTGG + Intronic
1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG + Intronic
1147661961 17:42121494-42121516 TCAATGTGGGGCCTTCACTCAGG - Exonic
1149239750 17:54635398-54635420 ACTAGGTAGGGCTTGGCCTCAGG - Intergenic
1154241827 18:12659125-12659147 ACTCTGTAGGGCTTTCACACAGG - Intronic
1159266587 18:66088166-66088188 ACTATTTAGGGCCTTTTTTCAGG + Intergenic
1167004037 19:46763874-46763896 ACTATGTAGCGTCTTGCATCTGG - Intronic
1167983520 19:53296520-53296542 AATATGTAGGGCCTTCAAGCAGG - Intergenic
932459544 2:71873344-71873366 ACTACTTAGGGCATCCCCTCAGG - Intergenic
933947995 2:87304273-87304295 ACTATGTAGGCCCATACCTAAGG - Intergenic
936332204 2:111557322-111557344 ACTATGTAGGCCCATACCTAAGG + Intergenic
946171374 2:217898014-217898036 GCTATCTGGGGCCTTCCCTGTGG - Intronic
946412991 2:219524716-219524738 ACTAGGTTGGGCTTTCCATCTGG + Intronic
947792947 2:232878138-232878160 ACTTTGTAGCGTCTTCCCACAGG - Intronic
1172872312 20:38143441-38143463 GGTATGCAGGGCCCTCCCTCCGG - Intronic
1173899977 20:46580649-46580671 ACAATATAGGACCTTCCCTGAGG + Intronic
1174946866 20:54995782-54995804 ACTATGTAGGGGCTGCCACCCGG + Intergenic
1176248171 20:64107257-64107279 AATCTGAAGGTCCTTCCCTCAGG + Intergenic
1185393374 22:50574419-50574441 GCCATGCTGGGCCTTCCCTCAGG - Exonic
961628630 3:128280674-128280696 CCTCTGTACGGTCTTCCCTCTGG + Intronic
962444119 3:135449732-135449754 ACTGTGTAGAGCCTTCACTGTGG - Intergenic
970122675 4:12774513-12774535 GCTATGTAGAGCCTTCGGTCAGG + Intergenic
971448757 4:26779980-26780002 GCTAGGTAAGGGCTTCCCTCTGG + Intergenic
980470921 4:133250521-133250543 ACTATATATGGCCTTTCTTCAGG - Intergenic
980585243 4:134805438-134805460 ACTTTGTAGGGCCAACCCACTGG - Intergenic
983892044 4:173039718-173039740 ACTATGTAGGGCCTACAAGCAGG - Intronic
990856356 5:60271572-60271594 ACTATATAGGGCCTTTTCTTTGG - Intronic
993940690 5:94054661-94054683 ACTATGTCTGGCCCACCCTCAGG + Intronic
994639509 5:102389354-102389376 ACTATGTAGAGGTTTCCCTCAGG - Intronic
994873171 5:105379509-105379531 ACCATGTAAGGTGTTCCCTCAGG - Intergenic
997780043 5:136647940-136647962 ACTAAGTTTGGCCTACCCTCAGG + Intergenic
1006934763 6:37709765-37709787 ACAGTGTAGGGCATGCCCTCTGG - Intergenic
1017322464 6:153109871-153109893 ACCATGTTGGGCTTTGCCTCAGG - Intronic
1021480600 7:21111408-21111430 CCAATGTAGGCCCTTACCTCTGG + Intergenic
1028937650 7:96484203-96484225 ACTCTGTAGGGCATAACCTCTGG - Intronic
1029381567 7:100218787-100218809 GCTCTTTAGAGCCTTCCCTCGGG + Intronic
1029401003 7:100346114-100346136 GCTCTTTAGAGCCTTCCCTCGGG + Intronic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1046132335 8:109981729-109981751 ACTATGTTTTGACTTCCCTCTGG - Intergenic
1047868396 8:129055113-129055135 ACTATGTAGCATCTTCTCTCTGG - Intergenic
1047991627 8:130292421-130292443 GCTTTGTAAAGCCTTCCCTCTGG - Intronic
1049045116 8:140143868-140143890 ACTATGTATGGTCTGCCATCTGG + Intronic
1052094677 9:24369747-24369769 ACTAGGTAGGGCCTCCCAGCTGG - Intergenic
1053144631 9:35704174-35704196 ACTAAGCTGGGCCCTCCCTCAGG - Exonic
1058045705 9:100354449-100354471 CCTTTCTAGGGCCTTCCCTTAGG + Intergenic
1186136810 X:6529928-6529950 ACAGTGGAAGGCCTTCCCTCTGG + Intergenic
1193391072 X:80929892-80929914 ACATTGTTGGGCCTTCCATCCGG + Intergenic
1195715732 X:107817076-107817098 GCTATGTAGTGCATTCTCTCAGG - Intergenic
1199634826 X:149805265-149805287 ATTATTTGGGGTCTTCCCTCTGG - Intergenic