ID: 1042683664

View in Genome Browser
Species Human (GRCh38)
Location 8:71414098-71414120
Sequence CCTACTCAGGATAACTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683664_1042683668 -9 Left 1042683664 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683664_1042683672 22 Left 1042683664 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
Right 1042683672 8:71414143-71414165 CACCCATATCAATCAATAGTTGG No data
1042683664_1042683675 29 Left 1042683664 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
Right 1042683675 8:71414150-71414172 ATCAATCAATAGTTGGATTCTGG No data
1042683664_1042683669 -1 Left 1042683664 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
Right 1042683669 8:71414120-71414142 GAGCTACAGGCCAGGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683664 Original CRISPR CCTACTCAGGATAACTATGT AGG (reversed) Intronic