ID: 1042683665

View in Genome Browser
Species Human (GRCh38)
Location 8:71414098-71414120
Sequence CCTACATAGTTATCCTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683662_1042683665 -10 Left 1042683662 8:71414085-71414107 CCAGAGGGAAGGCCCTACATAGT No data
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
1042683655_1042683665 12 Left 1042683655 8:71414063-71414085 CCTCCAGGAAGCTTCAGCTGCCC No data
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
1042683656_1042683665 9 Left 1042683656 8:71414066-71414088 CCAGGAAGCTTCAGCTGCCCCAG No data
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
1042683661_1042683665 -9 Left 1042683661 8:71414084-71414106 CCCAGAGGGAAGGCCCTACATAG No data
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
1042683660_1042683665 -8 Left 1042683660 8:71414083-71414105 CCCCAGAGGGAAGGCCCTACATA No data
Right 1042683665 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683665 Original CRISPR CCTACATAGTTATCCTGAGT AGG Intronic