ID: 1042683668

View in Genome Browser
Species Human (GRCh38)
Location 8:71414112-71414134
Sequence CTGAGTAGGAGCTACAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042683663_1042683668 -8 Left 1042683663 8:71414097-71414119 CCCTACATAGTTATCCTGAGTAG No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683656_1042683668 23 Left 1042683656 8:71414066-71414088 CCAGGAAGCTTCAGCTGCCCCAG No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683655_1042683668 26 Left 1042683655 8:71414063-71414085 CCTCCAGGAAGCTTCAGCTGCCC No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683660_1042683668 6 Left 1042683660 8:71414083-71414105 CCCCAGAGGGAAGGCCCTACATA No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683664_1042683668 -9 Left 1042683664 8:71414098-71414120 CCTACATAGTTATCCTGAGTAGG No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683661_1042683668 5 Left 1042683661 8:71414084-71414106 CCCAGAGGGAAGGCCCTACATAG No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data
1042683662_1042683668 4 Left 1042683662 8:71414085-71414107 CCAGAGGGAAGGCCCTACATAGT No data
Right 1042683668 8:71414112-71414134 CTGAGTAGGAGCTACAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042683668 Original CRISPR CTGAGTAGGAGCTACAGGCC AGG Intronic